FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624853_at:

>probe:Drosophila_2:1624853_at:683:335; Interrogation_Position=1062; Antisense; GCTGCCGCAGGTTGTGTGCACCGAT
>probe:Drosophila_2:1624853_at:80:51; Interrogation_Position=1085; Antisense; ATGCCCTGCTGGTCGGATTGTAAGC
>probe:Drosophila_2:1624853_at:104:657; Interrogation_Position=1105; Antisense; TAAGCAGCCTAAGCTGGCCAAGCGA
>probe:Drosophila_2:1624853_at:168:581; Interrogation_Position=1119; Antisense; TGGCCAAGCGACCATATCGACCTCG
>probe:Drosophila_2:1624853_at:525:533; Interrogation_Position=1190; Antisense; GGTCGTCAGTGGGTCAAAATTCATG
>probe:Drosophila_2:1624853_at:602:63; Interrogation_Position=1212; Antisense; ATGGTGAGAACCACGTCTGTCCCAG
>probe:Drosophila_2:1624853_at:369:291; Interrogation_Position=1225; Antisense; CGTCTGTCCCAGTGCCATAAAAAAG
>probe:Drosophila_2:1624853_at:643:625; Interrogation_Position=786; Antisense; TGCCCTCATTCGACGAGCTGTATTA
>probe:Drosophila_2:1624853_at:58:615; Interrogation_Position=821; Antisense; TGCAAGAACGGTCCTTACCAGCGCC
>probe:Drosophila_2:1624853_at:573:311; Interrogation_Position=843; Antisense; GCCACTGGGTGGAGTGCCCCAAGTT
>probe:Drosophila_2:1624853_at:50:321; Interrogation_Position=858; Antisense; GCCCCAAGTTCATGATCCGCAAGAA
>probe:Drosophila_2:1624853_at:592:109; Interrogation_Position=879; Antisense; AGAAGATAATCTGCGCCTACGACAA
>probe:Drosophila_2:1624853_at:553:121; Interrogation_Position=948; Antisense; AGCGGACAACGCTCAGTGCCACAGC
>probe:Drosophila_2:1624853_at:697:17; Interrogation_Position=990; Antisense; ATTTCGCTCCGTTGGCACGATGCGT

Paste this into a BLAST search page for me
GCTGCCGCAGGTTGTGTGCACCGATATGCCCTGCTGGTCGGATTGTAAGCTAAGCAGCCTAAGCTGGCCAAGCGATGGCCAAGCGACCATATCGACCTCGGGTCGTCAGTGGGTCAAAATTCATGATGGTGAGAACCACGTCTGTCCCAGCGTCTGTCCCAGTGCCATAAAAAAGTGCCCTCATTCGACGAGCTGTATTATGCAAGAACGGTCCTTACCAGCGCCGCCACTGGGTGGAGTGCCCCAAGTTGCCCCAAGTTCATGATCCGCAAGAAAGAAGATAATCTGCGCCTACGACAAAGCGGACAACGCTCAGTGCCACAGCATTTCGCTCCGTTGGCACGATGCGT

Full Affymetrix probeset data:

Annotations for 1624853_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720