FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624855_at:

>probe:Drosophila_2:1624855_at:114:635; Interrogation_Position=779; Antisense; TCGCGATTGCTTCCGGTGCAACAAG
>probe:Drosophila_2:1624855_at:559:463; Interrogation_Position=783; Antisense; GATTGCTTCCGGTGCAACAAGTGCG
>probe:Drosophila_2:1624855_at:384:187; Interrogation_Position=877; Antisense; AACATCGTCCCGGATAACCATGGTG
>probe:Drosophila_2:1624855_at:397:41; Interrogation_Position=880; Antisense; ATCGTCCCGGATAACCATGGTGCAT
>probe:Drosophila_2:1624855_at:702:543; Interrogation_Position=888; Antisense; GGATAACCATGGTGCATCCTTGCTC
>probe:Drosophila_2:1624855_at:332:659; Interrogation_Position=891; Antisense; TAACCATGGTGCATCCTTGCTCTTC
>probe:Drosophila_2:1624855_at:517:721; Interrogation_Position=907; Antisense; TTGCTCTTCCTCCAAATTGTTCATT
>probe:Drosophila_2:1624855_at:571:161; Interrogation_Position=920; Antisense; AAATTGTTCATTTGCTTGCTTACAA
>probe:Drosophila_2:1624855_at:549:19; Interrogation_Position=929; Antisense; ATTTGCTTGCTTACAATAATGTTGA
>probe:Drosophila_2:1624855_at:665:389; Interrogation_Position=952; Antisense; GAAATAGTTCCCGAAGCTTAGTAAG
>probe:Drosophila_2:1624855_at:90:469; Interrogation_Position=958; Antisense; GTTCCCGAAGCTTAGTAAGCCTAGA
>probe:Drosophila_2:1624855_at:295:205; Interrogation_Position=974; Antisense; AAGCCTAGAGGCATGCAAGAAAACA
>probe:Drosophila_2:1624855_at:187:361; Interrogation_Position=988; Antisense; GCAAGAAAACAGACTTACACATTTA
>probe:Drosophila_2:1624855_at:530:403; Interrogation_Position=999; Antisense; GACTTACACATTTAACACACAAACT

Paste this into a BLAST search page for me
TCGCGATTGCTTCCGGTGCAACAAGGATTGCTTCCGGTGCAACAAGTGCGAACATCGTCCCGGATAACCATGGTGATCGTCCCGGATAACCATGGTGCATGGATAACCATGGTGCATCCTTGCTCTAACCATGGTGCATCCTTGCTCTTCTTGCTCTTCCTCCAAATTGTTCATTAAATTGTTCATTTGCTTGCTTACAAATTTGCTTGCTTACAATAATGTTGAGAAATAGTTCCCGAAGCTTAGTAAGGTTCCCGAAGCTTAGTAAGCCTAGAAAGCCTAGAGGCATGCAAGAAAACAGCAAGAAAACAGACTTACACATTTAGACTTACACATTTAACACACAAACT

Full Affymetrix probeset data:

Annotations for 1624855_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720