FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624856_at:

>probe:Drosophila_2:1624856_at:246:467; Interrogation_Position=1688; Antisense; GTTGTATCTTGTTCGAGACCATTTT
>probe:Drosophila_2:1624856_at:25:419; Interrogation_Position=1729; Antisense; GAGCTAATTCGCTGGAAATGTACCA
>probe:Drosophila_2:1624856_at:626:729; Interrogation_Position=1762; Antisense; TTGGCAAAGAGTCCGCTAAGCTAAT
>probe:Drosophila_2:1624856_at:400:397; Interrogation_Position=1788; Antisense; GACAATCTTATGCTGAGTGAGACTC
>probe:Drosophila_2:1624856_at:434:485; Interrogation_Position=1859; Antisense; GTAGTTGACAATCTTCCACATTTTT
>probe:Drosophila_2:1624856_at:426:477; Interrogation_Position=1895; Antisense; GTTTTCTGTTATTGCTATTGTGTTA
>probe:Drosophila_2:1624856_at:622:467; Interrogation_Position=1930; Antisense; GTTGAGCCAATCTCTAACCTAGATG
>probe:Drosophila_2:1624856_at:362:571; Interrogation_Position=1954; Antisense; GGCTTTAATCTACTCTTTTTCCATA
>probe:Drosophila_2:1624856_at:301:249; Interrogation_Position=1992; Antisense; CAATTGAGCAACGATGTCCTGGATA
>probe:Drosophila_2:1624856_at:85:505; Interrogation_Position=2007; Antisense; GTCCTGGATAATTCGTTTCATTTCA
>probe:Drosophila_2:1624856_at:474:99; Interrogation_Position=2050; Antisense; AGATGTTACTTGTTGCTGTCTATAA
>probe:Drosophila_2:1624856_at:699:35; Interrogation_Position=2094; Antisense; ATCATATTAGTTTCGTGTACCCATT
>probe:Drosophila_2:1624856_at:639:539; Interrogation_Position=2179; Antisense; GGAGTAATTCTCTAAACCGTAATTG
>probe:Drosophila_2:1624856_at:362:643; Interrogation_Position=2221; Antisense; TCTCAATTTCTCTGACAACACCAAA

Paste this into a BLAST search page for me
GTTGTATCTTGTTCGAGACCATTTTGAGCTAATTCGCTGGAAATGTACCATTGGCAAAGAGTCCGCTAAGCTAATGACAATCTTATGCTGAGTGAGACTCGTAGTTGACAATCTTCCACATTTTTGTTTTCTGTTATTGCTATTGTGTTAGTTGAGCCAATCTCTAACCTAGATGGGCTTTAATCTACTCTTTTTCCATACAATTGAGCAACGATGTCCTGGATAGTCCTGGATAATTCGTTTCATTTCAAGATGTTACTTGTTGCTGTCTATAAATCATATTAGTTTCGTGTACCCATTGGAGTAATTCTCTAAACCGTAATTGTCTCAATTTCTCTGACAACACCAAA

Full Affymetrix probeset data:

Annotations for 1624856_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720