FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624857_at:

>probe:Drosophila_2:1624857_at:556:661; Interrogation_Position=100; Antisense; TAAACGAAGTTGTACCACAAGAAGA
>probe:Drosophila_2:1624857_at:427:461; Interrogation_Position=108; Antisense; GTTGTACCACAAGAAGATTTAGAAG
>probe:Drosophila_2:1624857_at:475:215; Interrogation_Position=121; Antisense; AAGATTTAGAAGTACGCATTCTGTC
>probe:Drosophila_2:1624857_at:104:287; Interrogation_Position=472; Antisense; CGGGAGAAATAGTAACGTCACCACT
>probe:Drosophila_2:1624857_at:554:647; Interrogation_Position=481; Antisense; TAGTAACGTCACCACTATTTAAGGA
>probe:Drosophila_2:1624857_at:121:31; Interrogation_Position=508; Antisense; ATAAAACATCGAAAGGTGCACATCA
>probe:Drosophila_2:1624857_at:617:41; Interrogation_Position=515; Antisense; ATCGAAAGGTGCACATCAAGATGTT
>probe:Drosophila_2:1624857_at:699:473; Interrogation_Position=563; Antisense; GTTAATTTACTACATCAACATTCTA
>probe:Drosophila_2:1624857_at:629:713; Interrogation_Position=583; Antisense; TTCTAATTAATCTTTATGTACGGTT
>probe:Drosophila_2:1624857_at:164:601; Interrogation_Position=59; Antisense; TGTATTTGCTAACAACATTTGCCAA
>probe:Drosophila_2:1624857_at:378:235; Interrogation_Position=591; Antisense; AATCTTTATGTACGGTTAAATCAAT
>probe:Drosophila_2:1624857_at:313:241; Interrogation_Position=613; Antisense; AATAAATTATCCAATTGTTGCTTGT
>probe:Drosophila_2:1624857_at:422:691; Interrogation_Position=76; Antisense; TTTGCCAAACAATGGAGGATCTTTT
>probe:Drosophila_2:1624857_at:578:249; Interrogation_Position=85; Antisense; CAATGGAGGATCTTTTAAACGAAGT

Paste this into a BLAST search page for me
TAAACGAAGTTGTACCACAAGAAGAGTTGTACCACAAGAAGATTTAGAAGAAGATTTAGAAGTACGCATTCTGTCCGGGAGAAATAGTAACGTCACCACTTAGTAACGTCACCACTATTTAAGGAATAAAACATCGAAAGGTGCACATCAATCGAAAGGTGCACATCAAGATGTTGTTAATTTACTACATCAACATTCTATTCTAATTAATCTTTATGTACGGTTTGTATTTGCTAACAACATTTGCCAAAATCTTTATGTACGGTTAAATCAATAATAAATTATCCAATTGTTGCTTGTTTTGCCAAACAATGGAGGATCTTTTCAATGGAGGATCTTTTAAACGAAGT

Full Affymetrix probeset data:

Annotations for 1624857_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720