FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624858_at:

>probe:Drosophila_2:1624858_at:44:437; Interrogation_Position=1010; Antisense; GAGGACGACTCCGACACTGTTGACT
>probe:Drosophila_2:1624858_at:373:143; Interrogation_Position=1025; Antisense; ACTGTTGACTTCAGCGCCTTCGAGA
>probe:Drosophila_2:1624858_at:116:525; Interrogation_Position=1135; Antisense; GGGCAAAAACTAGTGCCGTCCTCCA
>probe:Drosophila_2:1624858_at:454:647; Interrogation_Position=1164; Antisense; TCATCGTGCGCTCCTTAATATATAT
>probe:Drosophila_2:1624858_at:185:293; Interrogation_Position=1236; Antisense; CGTATACTTGTATTTTTCGCTAGAT
>probe:Drosophila_2:1624858_at:240:51; Interrogation_Position=1282; Antisense; ATGCGCTACCATTATTACCCAAAAG
>probe:Drosophila_2:1624858_at:282:365; Interrogation_Position=1344; Antisense; GAATACAACGTTATCACTGCGAAAT
>probe:Drosophila_2:1624858_at:586:259; Interrogation_Position=1358; Antisense; CACTGCGAAATGCTGCTATTCTGAT
>probe:Drosophila_2:1624858_at:465:671; Interrogation_Position=824; Antisense; TACGCGCGCGAATTCAAGGAGGCCA
>probe:Drosophila_2:1624858_at:281:1; Interrogation_Position=888; Antisense; AGGACGACCAGGATTTAGCCGACAA
>probe:Drosophila_2:1624858_at:141:397; Interrogation_Position=908; Antisense; GACAACGGTGGCGATTTGCAGCAAA
>probe:Drosophila_2:1624858_at:640:111; Interrogation_Position=927; Antisense; AGCAAATGATCCTGGCACGTCGCAA
>probe:Drosophila_2:1624858_at:329:431; Interrogation_Position=959; Antisense; GAGTCAAACTTTGGCTCCCTAATGG
>probe:Drosophila_2:1624858_at:42:229; Interrogation_Position=979; Antisense; AATGGACCGCCTGATGGAGAAGTAC

Paste this into a BLAST search page for me
GAGGACGACTCCGACACTGTTGACTACTGTTGACTTCAGCGCCTTCGAGAGGGCAAAAACTAGTGCCGTCCTCCATCATCGTGCGCTCCTTAATATATATCGTATACTTGTATTTTTCGCTAGATATGCGCTACCATTATTACCCAAAAGGAATACAACGTTATCACTGCGAAATCACTGCGAAATGCTGCTATTCTGATTACGCGCGCGAATTCAAGGAGGCCAAGGACGACCAGGATTTAGCCGACAAGACAACGGTGGCGATTTGCAGCAAAAGCAAATGATCCTGGCACGTCGCAAGAGTCAAACTTTGGCTCCCTAATGGAATGGACCGCCTGATGGAGAAGTAC

Full Affymetrix probeset data:

Annotations for 1624858_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720