FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624859_at:

>probe:Drosophila_2:1624859_at:199:431; Interrogation_Position=265; Antisense; GAGTCACAGTGGAGATTCCTGGCCA
>probe:Drosophila_2:1624859_at:696:501; Interrogation_Position=295; Antisense; GTCCTGGAAACCCTGCGCCAGTACA
>probe:Drosophila_2:1624859_at:634:313; Interrogation_Position=311; Antisense; GCCAGTACACTTCATGTCATCCGAA
>probe:Drosophila_2:1624859_at:101:107; Interrogation_Position=343; Antisense; AGAAAGTCCGGCAAATATCGCAAGC
>probe:Drosophila_2:1624859_at:403:685; Interrogation_Position=358; Antisense; TATCGCAAGCCATCGCAATGAGGAT
>probe:Drosophila_2:1624859_at:517:293; Interrogation_Position=371; Antisense; CGCAATGAGGATTCGAGTAACTAAC
>probe:Drosophila_2:1624859_at:488:387; Interrogation_Position=405; Antisense; GAAAACCAATAGTCCAGTCCAAAAT
>probe:Drosophila_2:1624859_at:381:31; Interrogation_Position=446; Antisense; ATAAGCATGAGCCAACCCAAAACCC
>probe:Drosophila_2:1624859_at:180:35; Interrogation_Position=488; Antisense; ATCAGCCGACGGCACTCGATTTCTA
>probe:Drosophila_2:1624859_at:527:355; Interrogation_Position=499; Antisense; GCACTCGATTTCTACTGCAGTCAAG
>probe:Drosophila_2:1624859_at:128:351; Interrogation_Position=515; Antisense; GCAGTCAAGGACACAGAGCCACAAC
>probe:Drosophila_2:1624859_at:566:91; Interrogation_Position=554; Antisense; AGTTTACTCATCAAAGCGATTGTGA
>probe:Drosophila_2:1624859_at:389:465; Interrogation_Position=571; Antisense; GATTGTGATAATGGTTTTGTTTCTA
>probe:Drosophila_2:1624859_at:105:375; Interrogation_Position=805; Antisense; GAAGATGAGTCGAAGTTGGCTAAAA

Paste this into a BLAST search page for me
GAGTCACAGTGGAGATTCCTGGCCAGTCCTGGAAACCCTGCGCCAGTACAGCCAGTACACTTCATGTCATCCGAAAGAAAGTCCGGCAAATATCGCAAGCTATCGCAAGCCATCGCAATGAGGATCGCAATGAGGATTCGAGTAACTAACGAAAACCAATAGTCCAGTCCAAAATATAAGCATGAGCCAACCCAAAACCCATCAGCCGACGGCACTCGATTTCTAGCACTCGATTTCTACTGCAGTCAAGGCAGTCAAGGACACAGAGCCACAACAGTTTACTCATCAAAGCGATTGTGAGATTGTGATAATGGTTTTGTTTCTAGAAGATGAGTCGAAGTTGGCTAAAA

Full Affymetrix probeset data:

Annotations for 1624859_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720