FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624860_at:

>probe:Drosophila_2:1624860_at:459:141; Interrogation_Position=193; Antisense; ACGGACACAGTGGATTCGGCTATGG
>probe:Drosophila_2:1624860_at:251:487; Interrogation_Position=220; Antisense; GTAGCTACCAGGCAAAGTGCATCCA
>probe:Drosophila_2:1624860_at:82:163; Interrogation_Position=418; Antisense; AAATTTGACAAGTTCCCGCAGGCGG
>probe:Drosophila_2:1624860_at:432:429; Interrogation_Position=443; Antisense; GAGTTTCCCGAAAGCAGGATGGCAA
>probe:Drosophila_2:1624860_at:668:561; Interrogation_Position=492; Antisense; GGAAGCACAATGTCGTCTGCGAACT
>probe:Drosophila_2:1624860_at:343:501; Interrogation_Position=503; Antisense; GTCGTCTGCGAACTGCCTTAAAATT
>probe:Drosophila_2:1624860_at:631:539; Interrogation_Position=579; Antisense; GGATTCTAAATCCTTACATGGTTCA
>probe:Drosophila_2:1624860_at:644:395; Interrogation_Position=611; Antisense; GAAATACCCGTCGATTGCAGACTAT
>probe:Drosophila_2:1624860_at:577:723; Interrogation_Position=625; Antisense; TTGCAGACTATGCAGGATCTCCCAC
>probe:Drosophila_2:1624860_at:498:591; Interrogation_Position=644; Antisense; TCCCACCCAGGGATTTCTTTGGTCT
>probe:Drosophila_2:1624860_at:573:713; Interrogation_Position=658; Antisense; TTCTTTGGTCTTTGCAGGGATTGCC
>probe:Drosophila_2:1624860_at:422:81; Interrogation_Position=673; Antisense; AGGGATTGCCGATCACGATGCAGAA
>probe:Drosophila_2:1624860_at:39:391; Interrogation_Position=695; Antisense; GAAATTGTGGCAGACGTCCTTCGGC
>probe:Drosophila_2:1624860_at:17:715; Interrogation_Position=714; Antisense; TTCGGCTGTCCTTATGGCAAGACGT

Paste this into a BLAST search page for me
ACGGACACAGTGGATTCGGCTATGGGTAGCTACCAGGCAAAGTGCATCCAAAATTTGACAAGTTCCCGCAGGCGGGAGTTTCCCGAAAGCAGGATGGCAAGGAAGCACAATGTCGTCTGCGAACTGTCGTCTGCGAACTGCCTTAAAATTGGATTCTAAATCCTTACATGGTTCAGAAATACCCGTCGATTGCAGACTATTTGCAGACTATGCAGGATCTCCCACTCCCACCCAGGGATTTCTTTGGTCTTTCTTTGGTCTTTGCAGGGATTGCCAGGGATTGCCGATCACGATGCAGAAGAAATTGTGGCAGACGTCCTTCGGCTTCGGCTGTCCTTATGGCAAGACGT

Full Affymetrix probeset data:

Annotations for 1624860_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720