FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624861_at:

>probe:Drosophila_2:1624861_at:75:691; Interrogation_Position=1073; Antisense; TTATTTCATGATGTTGGCAACCCTC
>probe:Drosophila_2:1624861_at:683:357; Interrogation_Position=1089; Antisense; GCAACCCTCAATTTTGGGAGCCTTT
>probe:Drosophila_2:1624861_at:128:555; Interrogation_Position=1105; Antisense; GGAGCCTTTTTCGAGATATATGGAC
>probe:Drosophila_2:1624861_at:599:439; Interrogation_Position=1175; Antisense; GATGTTAAGCTTTAACCCCTCCTTG
>probe:Drosophila_2:1624861_at:438:315; Interrogation_Position=679; Antisense; GCCGTTTCCCGAAGATTTGAGCAGT
>probe:Drosophila_2:1624861_at:334:267; Interrogation_Position=700; Antisense; CAGTCTATGCGGATTGTTTGCGCAA
>probe:Drosophila_2:1624861_at:629:539; Interrogation_Position=739; Antisense; GGATTTTAAGCCAGAAGCCGCAATT
>probe:Drosophila_2:1624861_at:702:265; Interrogation_Position=777; Antisense; CAGTTGGTAGTACGTTATCGGGTCA
>probe:Drosophila_2:1624861_at:163:703; Interrogation_Position=791; Antisense; TTATCGGGTCACACAGATCACTCTG
>probe:Drosophila_2:1624861_at:147:615; Interrogation_Position=814; Antisense; TGAACCAAACAAATCGGCCCCTTTG
>probe:Drosophila_2:1624861_at:397:211; Interrogation_Position=894; Antisense; AAGAAAAGCCAACCGCTATCTACCT
>probe:Drosophila_2:1624861_at:716:289; Interrogation_Position=946; Antisense; CGGAGAATCGCGTCTATGCTATCAC
>probe:Drosophila_2:1624861_at:125:681; Interrogation_Position=960; Antisense; TATGCTATCACGCAGTTCCTCGTAT
>probe:Drosophila_2:1624861_at:193:483; Interrogation_Position=981; Antisense; GTATCATCAAAACTCAGGCTTCCGC

Paste this into a BLAST search page for me
TTATTTCATGATGTTGGCAACCCTCGCAACCCTCAATTTTGGGAGCCTTTGGAGCCTTTTTCGAGATATATGGACGATGTTAAGCTTTAACCCCTCCTTGGCCGTTTCCCGAAGATTTGAGCAGTCAGTCTATGCGGATTGTTTGCGCAAGGATTTTAAGCCAGAAGCCGCAATTCAGTTGGTAGTACGTTATCGGGTCATTATCGGGTCACACAGATCACTCTGTGAACCAAACAAATCGGCCCCTTTGAAGAAAAGCCAACCGCTATCTACCTCGGAGAATCGCGTCTATGCTATCACTATGCTATCACGCAGTTCCTCGTATGTATCATCAAAACTCAGGCTTCCGC

Full Affymetrix probeset data:

Annotations for 1624861_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720