FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624866_at:

>probe:Drosophila_2:1624866_at:388:417; Interrogation_Position=1062; Antisense; GAGCGCTCCACTTCCAGGGATAGCA
>probe:Drosophila_2:1624866_at:619:261; Interrogation_Position=1097; Antisense; CAGCTCTTACGGACACAGGGCATAT
>probe:Drosophila_2:1624866_at:99:279; Interrogation_Position=1142; Antisense; CTACGTGGTCTTCAGTTCTGGGCCA
>probe:Drosophila_2:1624866_at:248:451; Interrogation_Position=1171; Antisense; GATCGCAGTCCGCTGAGAATACCTT
>probe:Drosophila_2:1624866_at:543:21; Interrogation_Position=1301; Antisense; ATATATGAGCTATGCCCCGGAGATG
>probe:Drosophila_2:1624866_at:281:65; Interrogation_Position=1323; Antisense; ATGGGAGGATACACTGGCTGCCAGC
>probe:Drosophila_2:1624866_at:297:491; Interrogation_Position=1391; Antisense; GTACACTACATGCATCGACTGTCTG
>probe:Drosophila_2:1624866_at:7:501; Interrogation_Position=1411; Antisense; GTCTGTACCAGAAGAGACCCTCCTA
>probe:Drosophila_2:1624866_at:46:281; Interrogation_Position=839; Antisense; CGGCGAGTCGGATCACAACTTGGAT
>probe:Drosophila_2:1624866_at:354:589; Interrogation_Position=859; Antisense; TGGATGTACCACATGGCAGTCGTAA
>probe:Drosophila_2:1624866_at:706:213; Interrogation_Position=882; Antisense; AAGAGGAGTATGTCTGCCCACGGCA
>probe:Drosophila_2:1624866_at:152:141; Interrogation_Position=901; Antisense; ACGGCAGCTTTGAGACGGGCACACG
>probe:Drosophila_2:1624866_at:559:253; Interrogation_Position=968; Antisense; CAACCAGACCTGCAGTGATCACTAT
>probe:Drosophila_2:1624866_at:438:85; Interrogation_Position=981; Antisense; AGTGATCACTATGTGGCTGCCGCAC

Paste this into a BLAST search page for me
GAGCGCTCCACTTCCAGGGATAGCACAGCTCTTACGGACACAGGGCATATCTACGTGGTCTTCAGTTCTGGGCCAGATCGCAGTCCGCTGAGAATACCTTATATATGAGCTATGCCCCGGAGATGATGGGAGGATACACTGGCTGCCAGCGTACACTACATGCATCGACTGTCTGGTCTGTACCAGAAGAGACCCTCCTACGGCGAGTCGGATCACAACTTGGATTGGATGTACCACATGGCAGTCGTAAAAGAGGAGTATGTCTGCCCACGGCAACGGCAGCTTTGAGACGGGCACACGCAACCAGACCTGCAGTGATCACTATAGTGATCACTATGTGGCTGCCGCAC

Full Affymetrix probeset data:

Annotations for 1624866_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720