FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624868_at:

>probe:Drosophila_2:1624868_at:636:85; Interrogation_Position=4618; Antisense; AGTGCCGTAGGGTATATTTATGCTT
>probe:Drosophila_2:1624868_at:64:613; Interrogation_Position=4650; Antisense; TGAAATCATACCAACGCATCGACAG
>probe:Drosophila_2:1624868_at:416:191; Interrogation_Position=4675; Antisense; AACTTGGTGCAGATGGCCATGGACT
>probe:Drosophila_2:1624868_at:505:457; Interrogation_Position=4700; Antisense; GATAGCAGTCGCAGTAGTTCTTGAT
>probe:Drosophila_2:1624868_at:220:89; Interrogation_Position=4712; Antisense; AGTAGTTCTTGATGCACTGCGACCG
>probe:Drosophila_2:1624868_at:684:683; Interrogation_Position=4799; Antisense; TATCCACACTTCTTTTCTTGGGCGA
>probe:Drosophila_2:1624868_at:448:575; Interrogation_Position=4819; Antisense; GGCGATGGCATGTTGCTGCCTTAAT
>probe:Drosophila_2:1624868_at:602:723; Interrogation_Position=4831; Antisense; TTGCTGCCTTAATCTCTTCCAGAAA
>probe:Drosophila_2:1624868_at:21:107; Interrogation_Position=4851; Antisense; AGAAACGAACTGATGACAGCTCCAA
>probe:Drosophila_2:1624868_at:442:547; Interrogation_Position=4897; Antisense; GGATGGCAACCCTTATACATATAAA
>probe:Drosophila_2:1624868_at:328:161; Interrogation_Position=5040; Antisense; ACAAGTGTCTAGTTTATATCGTTAT
>probe:Drosophila_2:1624868_at:360:455; Interrogation_Position=5071; Antisense; GATAATTTCCTTTGGTGTCTACATA
>probe:Drosophila_2:1624868_at:250:683; Interrogation_Position=5115; Antisense; TATGATATTGTTCTCCTCTACTCGT
>probe:Drosophila_2:1624868_at:225:281; Interrogation_Position=5127; Antisense; CTCCTCTACTCGTTTAGTCTACGAT

Paste this into a BLAST search page for me
AGTGCCGTAGGGTATATTTATGCTTTGAAATCATACCAACGCATCGACAGAACTTGGTGCAGATGGCCATGGACTGATAGCAGTCGCAGTAGTTCTTGATAGTAGTTCTTGATGCACTGCGACCGTATCCACACTTCTTTTCTTGGGCGAGGCGATGGCATGTTGCTGCCTTAATTTGCTGCCTTAATCTCTTCCAGAAAAGAAACGAACTGATGACAGCTCCAAGGATGGCAACCCTTATACATATAAAACAAGTGTCTAGTTTATATCGTTATGATAATTTCCTTTGGTGTCTACATATATGATATTGTTCTCCTCTACTCGTCTCCTCTACTCGTTTAGTCTACGAT

Full Affymetrix probeset data:

Annotations for 1624868_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720