FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624869_at:

>probe:Drosophila_2:1624869_at:219:431; Interrogation_Position=102; Antisense; GAGTAAGATTATGGCCGTGGCCGCT
>probe:Drosophila_2:1624869_at:251:583; Interrogation_Position=126; Antisense; TGGCGGTACCATTCTGGCGCTCGAG
>probe:Drosophila_2:1624869_at:475:241; Interrogation_Position=16; Antisense; AATAGCCTTAGCCAGAGGTCGCCGT
>probe:Drosophila_2:1624869_at:208:407; Interrogation_Position=167; Antisense; GACTGGTCCAGCTGGATGTGCTCAA
>probe:Drosophila_2:1624869_at:247:509; Interrogation_Position=184; Antisense; GTGCTCAAGACATTCTCACAGCTGG
>probe:Drosophila_2:1624869_at:29:151; Interrogation_Position=201; Antisense; ACAGCTGGAACAGGATCAGTCCCGG
>probe:Drosophila_2:1624869_at:230:555; Interrogation_Position=255; Antisense; GGAGCCAGTGAATCTTAACCGCGTT
>probe:Drosophila_2:1624869_at:100:215; Interrogation_Position=265; Antisense; AATCTTAACCGCGTTCAGGAACTTG
>probe:Drosophila_2:1624869_at:97:227; Interrogation_Position=304; Antisense; AAGGCGTGTGCAACCAGCGGTCGTC
>probe:Drosophila_2:1624869_at:115:79; Interrogation_Position=31; Antisense; AGGTCGCCGTACAGCCAGATCGGGA
>probe:Drosophila_2:1624869_at:367:121; Interrogation_Position=319; Antisense; AGCGGTCGTCTATGTGTGGCCTTCT
>probe:Drosophila_2:1624869_at:708:713; Interrogation_Position=353; Antisense; TTCTACTCGGCTTTGGATGGGCTTA
>probe:Drosophila_2:1624869_at:542:587; Interrogation_Position=56; Antisense; TGGGAGCTGCCGGTGGTTTTCTCAC
>probe:Drosophila_2:1624869_at:323:639; Interrogation_Position=86; Antisense; TCGTGCTCCTCAAGGCGAGTAAGAT

Paste this into a BLAST search page for me
GAGTAAGATTATGGCCGTGGCCGCTTGGCGGTACCATTCTGGCGCTCGAGAATAGCCTTAGCCAGAGGTCGCCGTGACTGGTCCAGCTGGATGTGCTCAAGTGCTCAAGACATTCTCACAGCTGGACAGCTGGAACAGGATCAGTCCCGGGGAGCCAGTGAATCTTAACCGCGTTAATCTTAACCGCGTTCAGGAACTTGAAGGCGTGTGCAACCAGCGGTCGTCAGGTCGCCGTACAGCCAGATCGGGAAGCGGTCGTCTATGTGTGGCCTTCTTTCTACTCGGCTTTGGATGGGCTTATGGGAGCTGCCGGTGGTTTTCTCACTCGTGCTCCTCAAGGCGAGTAAGAT

Full Affymetrix probeset data:

Annotations for 1624869_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720