FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624870_at:

>probe:Drosophila_2:1624870_at:293:495; Interrogation_Position=1010; Antisense; GTCAAACGATCTGCGCGCGAATTGG
>probe:Drosophila_2:1624870_at:635:361; Interrogation_Position=1028; Antisense; GAATTGGACGCTCCATCTGTGATTT
>probe:Drosophila_2:1624870_at:119:263; Interrogation_Position=1058; Antisense; CAGCCTTTTGTCTTTGTCTGCAAGT
>probe:Drosophila_2:1624870_at:486:251; Interrogation_Position=1086; Antisense; CAAGGATTGTGTCTTCTGTCTGGGT
>probe:Drosophila_2:1624870_at:472:691; Interrogation_Position=1123; Antisense; TTTGTGATCAGTGCCAGCTTCCTGA
>probe:Drosophila_2:1624870_at:421:55; Interrogation_Position=1229; Antisense; ATGAACTTGCCACACTGCGATTCAA
>probe:Drosophila_2:1624870_at:523:327; Interrogation_Position=1245; Antisense; GCGATTCAACGGAGGGTACTACTAC
>probe:Drosophila_2:1624870_at:168:309; Interrogation_Position=721; Antisense; CCAGGATCTCCTAAGCAGTTGCACA
>probe:Drosophila_2:1624870_at:384:563; Interrogation_Position=753; Antisense; GGAAGTAATCTGTCGCTTCTCACGC
>probe:Drosophila_2:1624870_at:74:715; Interrogation_Position=769; Antisense; TTCTCACGCGAGATTCCTGATGCAA
>probe:Drosophila_2:1624870_at:684:261; Interrogation_Position=814; Antisense; CAGCCGGCAGTGATTGTCCAAATTC
>probe:Drosophila_2:1624870_at:700:183; Interrogation_Position=840; Antisense; AAAATATCGCGAACTGGGAACCCAG
>probe:Drosophila_2:1624870_at:304:327; Interrogation_Position=897; Antisense; GCGTTTGGATCTGACCGACCTGAGA
>probe:Drosophila_2:1624870_at:329:259; Interrogation_Position=951; Antisense; CACGCTGCACACATTCACGATTAGT

Paste this into a BLAST search page for me
GTCAAACGATCTGCGCGCGAATTGGGAATTGGACGCTCCATCTGTGATTTCAGCCTTTTGTCTTTGTCTGCAAGTCAAGGATTGTGTCTTCTGTCTGGGTTTTGTGATCAGTGCCAGCTTCCTGAATGAACTTGCCACACTGCGATTCAAGCGATTCAACGGAGGGTACTACTACCCAGGATCTCCTAAGCAGTTGCACAGGAAGTAATCTGTCGCTTCTCACGCTTCTCACGCGAGATTCCTGATGCAACAGCCGGCAGTGATTGTCCAAATTCAAAATATCGCGAACTGGGAACCCAGGCGTTTGGATCTGACCGACCTGAGACACGCTGCACACATTCACGATTAGT

Full Affymetrix probeset data:

Annotations for 1624870_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720