Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624873_at:

>probe:Drosophila_2:1624873_at:411:725; Interrogation_Position=1612; Antisense; TTGTTCCTCATCAAGTGCGTCAAGG
>probe:Drosophila_2:1624873_at:227:421; Interrogation_Position=1685; Antisense; GAGACATCGAGATTGCCGGCAACGG
>probe:Drosophila_2:1624873_at:532:15; Interrogation_Position=1712; Antisense; ATTATCGGTCGGCTGGCACCAAGTC
>probe:Drosophila_2:1624873_at:337:251; Interrogation_Position=1731; Antisense; CAAGTCCAGTGCACCGCTGATGGGT
>probe:Drosophila_2:1624873_at:494:481; Interrogation_Position=1766; Antisense; GTATCAATGGAAGCGCACCAGCGTC
>probe:Drosophila_2:1624873_at:321:379; Interrogation_Position=1826; Antisense; GAACTGGGAAACTCGCCGTGACCAA
>probe:Drosophila_2:1624873_at:144:151; Interrogation_Position=1871; Antisense; ACAGGCAGTCGTCGCAATAACTCAA
>probe:Drosophila_2:1624873_at:518:183; Interrogation_Position=1932; Antisense; AAAAGTTCTGCCATTTTCCGCTGTA
>probe:Drosophila_2:1624873_at:235:311; Interrogation_Position=1983; Antisense; GCCAGCGCAAAATCGAGGTGTTCAT
>probe:Drosophila_2:1624873_at:31:27; Interrogation_Position=2015; Antisense; ATAGACCATAGCCATGTCGCACATG
>probe:Drosophila_2:1624873_at:153:503; Interrogation_Position=2030; Antisense; GTCGCACATGTTTCCAAGCATATGC
>probe:Drosophila_2:1624873_at:548:343; Interrogation_Position=2047; Antisense; GCATATGCTCATTCATCATCAGGTG
>probe:Drosophila_2:1624873_at:429:647; Interrogation_Position=2062; Antisense; TCATCAGGTGGAGACGCATTGCCGC
>probe:Drosophila_2:1624873_at:394:719; Interrogation_Position=2088; Antisense; TTCCCATCATCCATACGTGCATAAT

Paste this into a BLAST search page for me
TTGTTCCTCATCAAGTGCGTCAAGGGAGACATCGAGATTGCCGGCAACGGATTATCGGTCGGCTGGCACCAAGTCCAAGTCCAGTGCACCGCTGATGGGTGTATCAATGGAAGCGCACCAGCGTCGAACTGGGAAACTCGCCGTGACCAAACAGGCAGTCGTCGCAATAACTCAAAAAAGTTCTGCCATTTTCCGCTGTAGCCAGCGCAAAATCGAGGTGTTCATATAGACCATAGCCATGTCGCACATGGTCGCACATGTTTCCAAGCATATGCGCATATGCTCATTCATCATCAGGTGTCATCAGGTGGAGACGCATTGCCGCTTCCCATCATCCATACGTGCATAAT

Full Affymetrix probeset data:

Annotations for 1624873_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime