FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624874_at:

>probe:Drosophila_2:1624874_at:644:493; Interrogation_Position=211; Antisense; GTCAAGGGAATTGGCGCTTCTCGTA
>probe:Drosophila_2:1624874_at:406:633; Interrogation_Position=332; Antisense; TCACCTCGGACGTGGCTGTTTTAAA
>probe:Drosophila_2:1624874_at:307:171; Interrogation_Position=355; Antisense; AAACTAAAAGCTCCCATCAGCGGTC
>probe:Drosophila_2:1624874_at:524:221; Interrogation_Position=383; Antisense; AAGTGTCCACCATTGAGCTGTGCAA
>probe:Drosophila_2:1624874_at:117:27; Interrogation_Position=407; Antisense; ATACCAGCTTCAAGGCAGGCGATCT
>probe:Drosophila_2:1624874_at:344:573; Interrogation_Position=424; Antisense; GGCGATCTGATCAAGGTCTCTGGCT
>probe:Drosophila_2:1624874_at:516:707; Interrogation_Position=458; Antisense; TTACGGAGCGCAACAAGGCAGTTTC
>probe:Drosophila_2:1624874_at:171:479; Interrogation_Position=478; Antisense; GTTTCAATGCAGGTGCGCAGCGTAG
>probe:Drosophila_2:1624874_at:619:677; Interrogation_Position=500; Antisense; TAGATGTGGCGCTCATTCCGCGTAA
>probe:Drosophila_2:1624874_at:598:31; Interrogation_Position=542; Antisense; ATAAGCTGCGCGGAACCATCACCAA
>probe:Drosophila_2:1624874_at:83:189; Interrogation_Position=565; Antisense; AACACCATGTTTTGCGCCTCAGTGC
>probe:Drosophila_2:1624874_at:97:627; Interrogation_Position=630; Antisense; TGCCGTCTATCAGGGTCAACTATGC
>probe:Drosophila_2:1624874_at:366:101; Interrogation_Position=689; Antisense; AGAGTTCGCCGGGAGTCTATACCAA
>probe:Drosophila_2:1624874_at:110:341; Interrogation_Position=731; Antisense; GCTTTATCGACAAGGCTTTGGGCAT

Paste this into a BLAST search page for me
GTCAAGGGAATTGGCGCTTCTCGTATCACCTCGGACGTGGCTGTTTTAAAAAACTAAAAGCTCCCATCAGCGGTCAAGTGTCCACCATTGAGCTGTGCAAATACCAGCTTCAAGGCAGGCGATCTGGCGATCTGATCAAGGTCTCTGGCTTTACGGAGCGCAACAAGGCAGTTTCGTTTCAATGCAGGTGCGCAGCGTAGTAGATGTGGCGCTCATTCCGCGTAAATAAGCTGCGCGGAACCATCACCAAAACACCATGTTTTGCGCCTCAGTGCTGCCGTCTATCAGGGTCAACTATGCAGAGTTCGCCGGGAGTCTATACCAAGCTTTATCGACAAGGCTTTGGGCAT

Full Affymetrix probeset data:

Annotations for 1624874_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720