Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624875_at:

>probe:Drosophila_2:1624875_at:682:67; Interrogation_Position=266; Antisense; AGGCGAGCCGCATAACCGTCCAGGG
>probe:Drosophila_2:1624875_at:64:209; Interrogation_Position=301; Antisense; AAGCTCAGCCAGTCGGGCGTCGTGA
>probe:Drosophila_2:1624875_at:150:103; Interrogation_Position=325; Antisense; AGACGCGTGGCCAGGTACTTTATTC
>probe:Drosophila_2:1624875_at:359:147; Interrogation_Position=341; Antisense; ACTTTATTCCAAACGGCTTCAGCAG
>probe:Drosophila_2:1624875_at:306:121; Interrogation_Position=370; Antisense; AGCCTCAACTGGGACGTGGGCGTCA
>probe:Drosophila_2:1624875_at:63:497; Interrogation_Position=391; Antisense; GTCATCCGGCTGCAGAGTGCCTTGA
>probe:Drosophila_2:1624875_at:243:87; Interrogation_Position=406; Antisense; AGTGCCTTGACTGGCAGTGGCATCA
>probe:Drosophila_2:1624875_at:228:193; Interrogation_Position=469; Antisense; AACTACATGCGCGTCTCCGGCTGGG
>probe:Drosophila_2:1624875_at:69:347; Interrogation_Position=545; Antisense; GCATCCAGCTGATCCGCAAAAAGGT
>probe:Drosophila_2:1624875_at:48:171; Interrogation_Position=564; Antisense; AAAGGTGTGCCAGAGGGCCTACCAG
>probe:Drosophila_2:1624875_at:43:665; Interrogation_Position=583; Antisense; TACCAGGGAAGGGACACGCTCACCG
>probe:Drosophila_2:1624875_at:338:171; Interrogation_Position=637; Antisense; AAAGATAGCTGCTCCGGCGACTCAG
>probe:Drosophila_2:1624875_at:668:605; Interrogation_Position=671; Antisense; TGATCTTTAAGAACCAGCTCTGCGG
>probe:Drosophila_2:1624875_at:594:269; Interrogation_Position=774; Antisense; CATCCTCCGCTCCATTAAGAAGTGA

Paste this into a BLAST search page for me
AGGCGAGCCGCATAACCGTCCAGGGAAGCTCAGCCAGTCGGGCGTCGTGAAGACGCGTGGCCAGGTACTTTATTCACTTTATTCCAAACGGCTTCAGCAGAGCCTCAACTGGGACGTGGGCGTCAGTCATCCGGCTGCAGAGTGCCTTGAAGTGCCTTGACTGGCAGTGGCATCAAACTACATGCGCGTCTCCGGCTGGGGCATCCAGCTGATCCGCAAAAAGGTAAAGGTGTGCCAGAGGGCCTACCAGTACCAGGGAAGGGACACGCTCACCGAAAGATAGCTGCTCCGGCGACTCAGTGATCTTTAAGAACCAGCTCTGCGGCATCCTCCGCTCCATTAAGAAGTGA

Full Affymetrix probeset data:

Annotations for 1624875_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime