Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624877_at:

>probe:Drosophila_2:1624877_at:101:467; Interrogation_Position=1611; Antisense; GTTGGGCCTGCAGCTGATTAGACTA
>probe:Drosophila_2:1624877_at:259:345; Interrogation_Position=1669; Antisense; GCATTCGATGAACAGGTGGCTACCA
>probe:Drosophila_2:1624877_at:588:539; Interrogation_Position=1725; Antisense; GGTTCTACCCATTGTAACGATGCAG
>probe:Drosophila_2:1624877_at:13:413; Interrogation_Position=1765; Antisense; GACCTTCAGGCAATTAGCGAGCGCA
>probe:Drosophila_2:1624877_at:42:453; Interrogation_Position=1810; Antisense; GATCTCCATGGAGCTGGTTTCCTGG
>probe:Drosophila_2:1624877_at:403:575; Interrogation_Position=1834; Antisense; GGCGCGGGCAACGAGGCTACATTTA
>probe:Drosophila_2:1624877_at:239:513; Interrogation_Position=1876; Antisense; GTGATCCTCGACTGTGTGGACTTTA
>probe:Drosophila_2:1624877_at:526:149; Interrogation_Position=1904; Antisense; ACATATAGATGGCTCACCTTCTGGC
>probe:Drosophila_2:1624877_at:378:543; Interrogation_Position=1943; Antisense; GGATTCAGCCGAAGCTTCTTGGCAC
>probe:Drosophila_2:1624877_at:306:175; Interrogation_Position=1976; Antisense; AAACGCAGGGTGGACAACGTCTCGC
>probe:Drosophila_2:1624877_at:608:197; Interrogation_Position=1991; Antisense; AACGTCTCGCTGAGATCGCATTGAT
>probe:Drosophila_2:1624877_at:232:607; Interrogation_Position=2012; Antisense; TGATGCGGACTGATGCAGGCCAGAA
>probe:Drosophila_2:1624877_at:651:169; Interrogation_Position=2035; Antisense; AAAGGTCAGATACGACTGCGCGGTT
>probe:Drosophila_2:1624877_at:22:145; Interrogation_Position=2049; Antisense; ACTGCGCGGTTAGCGAGGCTGCAAA

Paste this into a BLAST search page for me
GTTGGGCCTGCAGCTGATTAGACTAGCATTCGATGAACAGGTGGCTACCAGGTTCTACCCATTGTAACGATGCAGGACCTTCAGGCAATTAGCGAGCGCAGATCTCCATGGAGCTGGTTTCCTGGGGCGCGGGCAACGAGGCTACATTTAGTGATCCTCGACTGTGTGGACTTTAACATATAGATGGCTCACCTTCTGGCGGATTCAGCCGAAGCTTCTTGGCACAAACGCAGGGTGGACAACGTCTCGCAACGTCTCGCTGAGATCGCATTGATTGATGCGGACTGATGCAGGCCAGAAAAAGGTCAGATACGACTGCGCGGTTACTGCGCGGTTAGCGAGGCTGCAAA

Full Affymetrix probeset data:

Annotations for 1624877_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime