Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624879_at:

>probe:Drosophila_2:1624879_at:714:491; Interrogation_Position=143; Antisense; GTAACAGCAGCCACACGAGTCTCAA
>probe:Drosophila_2:1624879_at:506:393; Interrogation_Position=208; Antisense; GAAATTCCTTCGAGTAACAGCCATA
>probe:Drosophila_2:1624879_at:95:229; Interrogation_Position=241; Antisense; AATGGCAACATCGTCACCAGAGCAA
>probe:Drosophila_2:1624879_at:509:563; Interrogation_Position=282; Antisense; GGCACGATTTCACTCCGAGTTTCGA
>probe:Drosophila_2:1624879_at:293:479; Interrogation_Position=300; Antisense; GTTTCGACTCGATTCAAGTGGCCAA
>probe:Drosophila_2:1624879_at:16:259; Interrogation_Position=342; Antisense; CACTCAATTGGTGCACAGGCGGCGC
>probe:Drosophila_2:1624879_at:117:577; Interrogation_Position=362; Antisense; GGCGCGGACTGGGAAAGCACTCAAA
>probe:Drosophila_2:1624879_at:35:129; Interrogation_Position=396; Antisense; ACCACTGCGGAACTCGTTATGCGGG
>probe:Drosophila_2:1624879_at:28:255; Interrogation_Position=41; Antisense; CAACATTGGTAGCTTTTCTAGGCAA
>probe:Drosophila_2:1624879_at:527:319; Interrogation_Position=469; Antisense; GCCGACGACAGATGTGCGCTCAAAA
>probe:Drosophila_2:1624879_at:698:181; Interrogation_Position=491; Antisense; AAAACCAGTTGAGCGAGTTCTCGAG
>probe:Drosophila_2:1624879_at:537:623; Interrogation_Position=553; Antisense; TGCGTACGGCTGGTTCATCATCATA
>probe:Drosophila_2:1624879_at:106:37; Interrogation_Position=569; Antisense; ATCATCATACCTGTGGTGGTGGCGG
>probe:Drosophila_2:1624879_at:116:173; Interrogation_Position=613; Antisense; AAACCGGGCGTGAGCCGAGCCAGTT

Paste this into a BLAST search page for me
GTAACAGCAGCCACACGAGTCTCAAGAAATTCCTTCGAGTAACAGCCATAAATGGCAACATCGTCACCAGAGCAAGGCACGATTTCACTCCGAGTTTCGAGTTTCGACTCGATTCAAGTGGCCAACACTCAATTGGTGCACAGGCGGCGCGGCGCGGACTGGGAAAGCACTCAAAACCACTGCGGAACTCGTTATGCGGGCAACATTGGTAGCTTTTCTAGGCAAGCCGACGACAGATGTGCGCTCAAAAAAAACCAGTTGAGCGAGTTCTCGAGTGCGTACGGCTGGTTCATCATCATAATCATCATACCTGTGGTGGTGGCGGAAACCGGGCGTGAGCCGAGCCAGTT

Full Affymetrix probeset data:

Annotations for 1624879_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime