FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624880_at:

>probe:Drosophila_2:1624880_at:610:215; Interrogation_Position=422; Antisense; AAGATCTTACGTACAGTCTACCCGG
>probe:Drosophila_2:1624880_at:423:133; Interrogation_Position=441; Antisense; ACCCGGATCTGTATGAACGCCTGAA
>probe:Drosophila_2:1624880_at:28:201; Interrogation_Position=456; Antisense; AACGCCTGAAGGTCATGCCCAAGGA
>probe:Drosophila_2:1624880_at:503:483; Interrogation_Position=510; Antisense; GTATGAACACCACCTATCAGATCGA
>probe:Drosophila_2:1624880_at:284:555; Interrogation_Position=589; Antisense; GGACGAGTCCAAGAACGCCAACAAG
>probe:Drosophila_2:1624880_at:360:607; Interrogation_Position=615; Antisense; TGATGAGCGAACGTGGACCCTGCAA
>probe:Drosophila_2:1624880_at:364:197; Interrogation_Position=638; Antisense; AACGAGTTCCGCTCGAACGTGATGA
>probe:Drosophila_2:1624880_at:405:329; Interrogation_Position=680; Antisense; GCGTCCGCTGGCTACGAGATGTCTA
>probe:Drosophila_2:1624880_at:335:427; Interrogation_Position=695; Antisense; GAGATGTCTAGCGACGAGTGCCAAA
>probe:Drosophila_2:1624880_at:349:103; Interrogation_Position=762; Antisense; AGACCATCGAATCCGGCAGCAGTTC
>probe:Drosophila_2:1624880_at:179:563; Interrogation_Position=858; Antisense; GGAACGGCTGCGTCATCATGCGCAA
>probe:Drosophila_2:1624880_at:631:185; Interrogation_Position=881; Antisense; AACAAGTTGCACGATCACTCCAAGT
>probe:Drosophila_2:1624880_at:185:615; Interrogation_Position=920; Antisense; TGCAAGCACGAGCTCAAGTTCACTT
>probe:Drosophila_2:1624880_at:484:505; Interrogation_Position=964; Antisense; GTCCAAAGACTAGTGCATCTCGAGT

Paste this into a BLAST search page for me
AAGATCTTACGTACAGTCTACCCGGACCCGGATCTGTATGAACGCCTGAAAACGCCTGAAGGTCATGCCCAAGGAGTATGAACACCACCTATCAGATCGAGGACGAGTCCAAGAACGCCAACAAGTGATGAGCGAACGTGGACCCTGCAAAACGAGTTCCGCTCGAACGTGATGAGCGTCCGCTGGCTACGAGATGTCTAGAGATGTCTAGCGACGAGTGCCAAAAGACCATCGAATCCGGCAGCAGTTCGGAACGGCTGCGTCATCATGCGCAAAACAAGTTGCACGATCACTCCAAGTTGCAAGCACGAGCTCAAGTTCACTTGTCCAAAGACTAGTGCATCTCGAGT

Full Affymetrix probeset data:

Annotations for 1624880_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720