Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624881_at:

>probe:Drosophila_2:1624881_at:576:187; Interrogation_Position=3258; Antisense; AACACCCGACTTACCAATCTCAATT
>probe:Drosophila_2:1624881_at:292:239; Interrogation_Position=3273; Antisense; AATCTCAATTAACCCATCTCGTTTC
>probe:Drosophila_2:1624881_at:367:13; Interrogation_Position=3288; Antisense; ATCTCGTTTCGAACACAACAAAGAG
>probe:Drosophila_2:1624881_at:273:211; Interrogation_Position=3308; Antisense; AAGAGTGGCAACTGAACTTTTATAA
>probe:Drosophila_2:1624881_at:598:185; Interrogation_Position=3338; Antisense; AACACGAGCGCGCAATGGCATCGAT
>probe:Drosophila_2:1624881_at:707:709; Interrogation_Position=3570; Antisense; TTCAAAGCGTACCAGGGTGGCACTT
>probe:Drosophila_2:1624881_at:132:533; Interrogation_Position=3585; Antisense; GGTGGCACTTGGACCATGGACTGCA
>probe:Drosophila_2:1624881_at:691:405; Interrogation_Position=3603; Antisense; GACTGCAGGAGCGACCAGAGCGATA
>probe:Drosophila_2:1624881_at:617:325; Interrogation_Position=3622; Antisense; GCGATAGCGAGCATCGGATCGGATC
>probe:Drosophila_2:1624881_at:139:589; Interrogation_Position=3651; Antisense; TGGATCGCATCATGGTGAACCGCAT
>probe:Drosophila_2:1624881_at:566:613; Interrogation_Position=3666; Antisense; TGAACCGCATCAGAGGGCGACGCCT
>probe:Drosophila_2:1624881_at:393:649; Interrogation_Position=3712; Antisense; TCACCCCTGTACGTACATCAAATTT
>probe:Drosophila_2:1624881_at:220:705; Interrogation_Position=3735; Antisense; TTATGAGTGGCTTCCTTTGAGCGAC
>probe:Drosophila_2:1624881_at:696:273; Interrogation_Position=3745; Antisense; CTTCCTTTGAGCGACCACCAAAATA

Paste this into a BLAST search page for me
AACACCCGACTTACCAATCTCAATTAATCTCAATTAACCCATCTCGTTTCATCTCGTTTCGAACACAACAAAGAGAAGAGTGGCAACTGAACTTTTATAAAACACGAGCGCGCAATGGCATCGATTTCAAAGCGTACCAGGGTGGCACTTGGTGGCACTTGGACCATGGACTGCAGACTGCAGGAGCGACCAGAGCGATAGCGATAGCGAGCATCGGATCGGATCTGGATCGCATCATGGTGAACCGCATTGAACCGCATCAGAGGGCGACGCCTTCACCCCTGTACGTACATCAAATTTTTATGAGTGGCTTCCTTTGAGCGACCTTCCTTTGAGCGACCACCAAAATA

Full Affymetrix probeset data:

Annotations for 1624881_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime