FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624882_at:

>probe:Drosophila_2:1624882_at:248:401; Interrogation_Position=1240; Antisense; GTTACCCAAGGACAAATTCTGCGCA
>probe:Drosophila_2:1624882_at:572:491; Interrogation_Position=1297; Antisense; GTAAATCAACTTCTCCTTGGATATA
>probe:Drosophila_2:1624882_at:234:3; Interrogation_Position=1467; Antisense; ATTGGCTTTGTTCAACCAGACCCAG
>probe:Drosophila_2:1624882_at:247:459; Interrogation_Position=1499; Antisense; GATATTACTCCGTAGAAGCTGTCAT
>probe:Drosophila_2:1624882_at:556:377; Interrogation_Position=1513; Antisense; GAAGCTGTCATCAAAGCCTGGACCC
>probe:Drosophila_2:1624882_at:450:57; Interrogation_Position=1559; Antisense; ATGATCTAACTCACGCTTTAAGCAT
>probe:Drosophila_2:1624882_at:37:209; Interrogation_Position=1578; Antisense; AAGCATTTCTCAAAAGCGCACCGAC
>probe:Drosophila_2:1624882_at:98:207; Interrogation_Position=1591; Antisense; AAGCGCACCGACTTGGCAATTGCCA
>probe:Drosophila_2:1624882_at:138:721; Interrogation_Position=1610; Antisense; TTGCCATTAGCGGATCTGCGGAGTA
>probe:Drosophila_2:1624882_at:219:31; Interrogation_Position=1634; Antisense; ATAATACTGAAACCTATCCGACCCG
>probe:Drosophila_2:1624882_at:472:683; Interrogation_Position=1648; Antisense; TATCCGACCCGTTTTATAAGCTATA
>probe:Drosophila_2:1624882_at:78:381; Interrogation_Position=1709; Antisense; GAACCCCACAGATCTTAGGTGCTGA
>probe:Drosophila_2:1624882_at:356:659; Interrogation_Position=1737; Antisense; TAACGCATTGGAGTCATCGTGGAAT
>probe:Drosophila_2:1624882_at:588:639; Interrogation_Position=1753; Antisense; TCGTGGAATGTTGTGGCACCAGCAT

Paste this into a BLAST search page for me
GTTACCCAAGGACAAATTCTGCGCAGTAAATCAACTTCTCCTTGGATATAATTGGCTTTGTTCAACCAGACCCAGGATATTACTCCGTAGAAGCTGTCATGAAGCTGTCATCAAAGCCTGGACCCATGATCTAACTCACGCTTTAAGCATAAGCATTTCTCAAAAGCGCACCGACAAGCGCACCGACTTGGCAATTGCCATTGCCATTAGCGGATCTGCGGAGTAATAATACTGAAACCTATCCGACCCGTATCCGACCCGTTTTATAAGCTATAGAACCCCACAGATCTTAGGTGCTGATAACGCATTGGAGTCATCGTGGAATTCGTGGAATGTTGTGGCACCAGCAT

Full Affymetrix probeset data:

Annotations for 1624882_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720