FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624883_at:

>probe:Drosophila_2:1624883_at:131:321; Interrogation_Position=105; Antisense; GGAAAAGGAAGGCATTCCGCCCCAG
>probe:Drosophila_2:1624883_at:337:111; Interrogation_Position=128; Antisense; AGCAACAGCGTCTTATTTTCTCCGG
>probe:Drosophila_2:1624883_at:41:499; Interrogation_Position=137; Antisense; GTCTTATTTTCTCCGGCAAGCAAAT
>probe:Drosophila_2:1624883_at:136:211; Interrogation_Position=163; Antisense; AATGACGATAAAACCGCGGCGGACT
>probe:Drosophila_2:1624883_at:658:31; Interrogation_Position=19; Antisense; ATCAAAGTGAAGACCCTGACCGGCA
>probe:Drosophila_2:1624883_at:702:219; Interrogation_Position=191; Antisense; AAGTGCAAGGTGGATCCGTTCTTCA
>probe:Drosophila_2:1624883_at:64:449; Interrogation_Position=203; Antisense; GATCCGTTCTTCACTTGGTATTGGC
>probe:Drosophila_2:1624883_at:85:277; Interrogation_Position=211; Antisense; CTTCACTTGGTATTGGCTCTGCGAG
>probe:Drosophila_2:1624883_at:635:571; Interrogation_Position=225; Antisense; GGCTCTGCGAGGAGGTGATTCAATC
>probe:Drosophila_2:1624883_at:539:461; Interrogation_Position=241; Antisense; GATTCAATCCTAACACCTTGTGTGT
>probe:Drosophila_2:1624883_at:686:409; Interrogation_Position=30; Antisense; GACCCTGACCGGCAAGGAAATCGAG
>probe:Drosophila_2:1624883_at:698:559; Interrogation_Position=45; Antisense; GGAAATCGAGATCGACATTGAGCCC
>probe:Drosophila_2:1624883_at:539:5; Interrogation_Position=61; Antisense; ATTGAGCCCACGGACAAGGTAGATC
>probe:Drosophila_2:1624883_at:665:677; Interrogation_Position=80; Antisense; TAGATCGCATCAAGGAGCGCGTGGA

Paste this into a BLAST search page for me
GGAAAAGGAAGGCATTCCGCCCCAGAGCAACAGCGTCTTATTTTCTCCGGGTCTTATTTTCTCCGGCAAGCAAATAATGACGATAAAACCGCGGCGGACTATCAAAGTGAAGACCCTGACCGGCAAAGTGCAAGGTGGATCCGTTCTTCAGATCCGTTCTTCACTTGGTATTGGCCTTCACTTGGTATTGGCTCTGCGAGGGCTCTGCGAGGAGGTGATTCAATCGATTCAATCCTAACACCTTGTGTGTGACCCTGACCGGCAAGGAAATCGAGGGAAATCGAGATCGACATTGAGCCCATTGAGCCCACGGACAAGGTAGATCTAGATCGCATCAAGGAGCGCGTGGA

Full Affymetrix probeset data:

Annotations for 1624883_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720