FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624884_at:

>probe:Drosophila_2:1624884_at:149:133; Interrogation_Position=109; Antisense; ACCCTGATCGTTGGCAATCCGGATG
>probe:Drosophila_2:1624884_at:657:53; Interrogation_Position=131; Antisense; ATGCAGCGCATCTTAGCCGGCAGGA
>probe:Drosophila_2:1624884_at:266:689; Interrogation_Position=163; Antisense; TATTTGCGCTGGACGGTGGTGTTCA
>probe:Drosophila_2:1624884_at:259:461; Interrogation_Position=24; Antisense; GATTATTCACATCGAACTGGACGCC
>probe:Drosophila_2:1624884_at:342:245; Interrogation_Position=241; Antisense; AATTTTGAGATTAGCCTGGCCACCT
>probe:Drosophila_2:1624884_at:199:293; Interrogation_Position=272; Antisense; CGATGATGCTGATGGGATCCCTGCT
>probe:Drosophila_2:1624884_at:672:305; Interrogation_Position=291; Antisense; CCTGCTATCGGTGCTTCTGGTTATG
>probe:Drosophila_2:1624884_at:652:589; Interrogation_Position=308; Antisense; TGGTTATGGTCACCGTTGCTCTCCA
>probe:Drosophila_2:1624884_at:298:35; Interrogation_Position=332; Antisense; ATCAGCATGAACCATTCCCGGATCT
>probe:Drosophila_2:1624884_at:546:539; Interrogation_Position=372; Antisense; GGTTGTCTACCACTTGTACTACATC
>probe:Drosophila_2:1624884_at:510:37; Interrogation_Position=412; Antisense; ATCTCAGTGGTGTTCTTCCTGGTCC
>probe:Drosophila_2:1624884_at:238:553; Interrogation_Position=447; Antisense; GGAGCTGCTGCTGCATCGTTTACAG
>probe:Drosophila_2:1624884_at:495:281; Interrogation_Position=48; Antisense; CTCCGTTGACGTGACCATGCAATTG
>probe:Drosophila_2:1624884_at:179:459; Interrogation_Position=85; Antisense; GATTTGGACGTACGCTGCCATGGCA

Paste this into a BLAST search page for me
ACCCTGATCGTTGGCAATCCGGATGATGCAGCGCATCTTAGCCGGCAGGATATTTGCGCTGGACGGTGGTGTTCAGATTATTCACATCGAACTGGACGCCAATTTTGAGATTAGCCTGGCCACCTCGATGATGCTGATGGGATCCCTGCTCCTGCTATCGGTGCTTCTGGTTATGTGGTTATGGTCACCGTTGCTCTCCAATCAGCATGAACCATTCCCGGATCTGGTTGTCTACCACTTGTACTACATCATCTCAGTGGTGTTCTTCCTGGTCCGGAGCTGCTGCTGCATCGTTTACAGCTCCGTTGACGTGACCATGCAATTGGATTTGGACGTACGCTGCCATGGCA

Full Affymetrix probeset data:

Annotations for 1624884_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720