Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624887_at:

>probe:Drosophila_2:1624887_at:572:347; Interrogation_Position=1410; Antisense; GCAGGCCCAGACCATTGCTGAAGTG
>probe:Drosophila_2:1624887_at:413:723; Interrogation_Position=1424; Antisense; TTGCTGAAGTGCGAGCTGCCCTGGA
>probe:Drosophila_2:1624887_at:198:419; Interrogation_Position=1436; Antisense; GAGCTGCCCTGGATAGCTACATCAA
>probe:Drosophila_2:1624887_at:315:501; Interrogation_Position=1506; Antisense; GTCGTCAGCCAATGGAGCCGCCAGC
>probe:Drosophila_2:1624887_at:55:415; Interrogation_Position=1575; Antisense; GACCATTAGCAGCAGTTCGGCCAAG
>probe:Drosophila_2:1624887_at:613:205; Interrogation_Position=1597; Antisense; AAGCCCACAGACATCACACATTTGA
>probe:Drosophila_2:1624887_at:226:109; Interrogation_Position=1631; Antisense; AGAAGCCGGAGGATCCCAGCTCGGA
>probe:Drosophila_2:1624887_at:616:661; Interrogation_Position=1754; Antisense; TAAAATACACCACACTCATCGGCTA
>probe:Drosophila_2:1624887_at:37:157; Interrogation_Position=1765; Antisense; ACACTCATCGGCTACTTAAACCAAC
>probe:Drosophila_2:1624887_at:606:541; Interrogation_Position=1781; Antisense; TAAACCAACCCACACGCATTAAACA
>probe:Drosophila_2:1624887_at:694:177; Interrogation_Position=1801; Antisense; AAACACCATTCAACTGTCCTATACC
>probe:Drosophila_2:1624887_at:169:631; Interrogation_Position=1817; Antisense; TCCTATACCTCGAACCTACATATTT
>probe:Drosophila_2:1624887_at:349:339; Interrogation_Position=1844; Antisense; GCTACTTGTTTGCTGTTTTCTACCA
>probe:Drosophila_2:1624887_at:370:123; Interrogation_Position=1865; Antisense; ACCAAAATTCTCTGTAAGTCTGTAA

Paste this into a BLAST search page for me
GCAGGCCCAGACCATTGCTGAAGTGTTGCTGAAGTGCGAGCTGCCCTGGAGAGCTGCCCTGGATAGCTACATCAAGTCGTCAGCCAATGGAGCCGCCAGCGACCATTAGCAGCAGTTCGGCCAAGAAGCCCACAGACATCACACATTTGAAGAAGCCGGAGGATCCCAGCTCGGATAAAATACACCACACTCATCGGCTAACACTCATCGGCTACTTAAACCAACTAAACCAACCCACACGCATTAAACAAAACACCATTCAACTGTCCTATACCTCCTATACCTCGAACCTACATATTTGCTACTTGTTTGCTGTTTTCTACCAACCAAAATTCTCTGTAAGTCTGTAA

Full Affymetrix probeset data:

Annotations for 1624887_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime