FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624888_at:

>probe:Drosophila_2:1624888_at:229:87; Interrogation_Position=490; Antisense; AGTGCCCTGATACTGAACATCCTCA
>probe:Drosophila_2:1624888_at:248:45; Interrogation_Position=508; Antisense; ATCCTCAATTACTTTCGGTTCCTGA
>probe:Drosophila_2:1624888_at:113:401; Interrogation_Position=534; Antisense; GACAGGACGAAAACCCACTTTGGTG
>probe:Drosophila_2:1624888_at:512:557; Interrogation_Position=558; Antisense; GGACTACTTATTGGGATTGGACTAC
>probe:Drosophila_2:1624888_at:247:403; Interrogation_Position=577; Antisense; GACTACATTAGTCTGCGGAACAATC
>probe:Drosophila_2:1624888_at:721:423; Interrogation_Position=608; Antisense; GAGACATTGGCTACAAGTACCTAAC
>probe:Drosophila_2:1624888_at:364:395; Interrogation_Position=661; Antisense; GAAATCCTCGGACTGGTGTTGCCCA
>probe:Drosophila_2:1624888_at:394:721; Interrogation_Position=679; Antisense; TTGCCCATCATCAATTTCCGTAAGC
>probe:Drosophila_2:1624888_at:636:645; Interrogation_Position=721; Antisense; TCATGGACATTTTCCGGACGACGGT
>probe:Drosophila_2:1624888_at:39:543; Interrogation_Position=750; Antisense; GGATAGAGATGGTCCGGCTTTCCTG
>probe:Drosophila_2:1624888_at:130:583; Interrogation_Position=773; Antisense; TGGCGCCGCAGATGACACTAAGCAC
>probe:Drosophila_2:1624888_at:208:617; Interrogation_Position=802; Antisense; TGCACATTCTGTGGAGAGCGACCCA
>probe:Drosophila_2:1624888_at:238:709; Interrogation_Position=889; Antisense; TTAACGGATGCCAGTTTCTGCTGCC
>probe:Drosophila_2:1624888_at:459:329; Interrogation_Position=928; Antisense; GCGTGTCCTGAGTCGGGAATCCAAA

Paste this into a BLAST search page for me
AGTGCCCTGATACTGAACATCCTCAATCCTCAATTACTTTCGGTTCCTGAGACAGGACGAAAACCCACTTTGGTGGGACTACTTATTGGGATTGGACTACGACTACATTAGTCTGCGGAACAATCGAGACATTGGCTACAAGTACCTAACGAAATCCTCGGACTGGTGTTGCCCATTGCCCATCATCAATTTCCGTAAGCTCATGGACATTTTCCGGACGACGGTGGATAGAGATGGTCCGGCTTTCCTGTGGCGCCGCAGATGACACTAAGCACTGCACATTCTGTGGAGAGCGACCCATTAACGGATGCCAGTTTCTGCTGCCGCGTGTCCTGAGTCGGGAATCCAAA

Full Affymetrix probeset data:

Annotations for 1624888_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720