FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624891_at:

>probe:Drosophila_2:1624891_at:99:167; Interrogation_Position=1656; Antisense; AAATGTCCCTCTGGGATGCACGTAG
>probe:Drosophila_2:1624891_at:168:617; Interrogation_Position=1672; Antisense; TGCACGTAGTCTGATCAGCGCACAT
>probe:Drosophila_2:1624891_at:269:55; Interrogation_Position=1695; Antisense; ATGAATGATCACTTTGGCTGGCCCT
>probe:Drosophila_2:1624891_at:650:573; Interrogation_Position=1710; Antisense; GGCTGGCCCTAATTTATTCATCGTC
>probe:Drosophila_2:1624891_at:81:13; Interrogation_Position=1725; Antisense; ATTCATCGTCTAGCGTTAATTCTAA
>probe:Drosophila_2:1624891_at:265:171; Interrogation_Position=1762; Antisense; AAAGCCTACGATTAAGTTTGGTCAG
>probe:Drosophila_2:1624891_at:632:647; Interrogation_Position=1794; Antisense; TCATCGATTCACTGGATCACTGTGG
>probe:Drosophila_2:1624891_at:259:35; Interrogation_Position=1809; Antisense; ATCACTGTGGAGTGCATTTCGCTCA
>probe:Drosophila_2:1624891_at:691:507; Interrogation_Position=1820; Antisense; GTGCATTTCGCTCAGTTTTGTGATA
>probe:Drosophila_2:1624891_at:235:261; Interrogation_Position=1859; Antisense; CAGCCATTTAGCGTACGTCACTTAA
>probe:Drosophila_2:1624891_at:263:119; Interrogation_Position=1885; Antisense; ACGCACTAACTCTAATTAACCGCAG
>probe:Drosophila_2:1624891_at:566:425; Interrogation_Position=2002; Antisense; GAGAGAATGTCCTAGAGCCCACGAT
>probe:Drosophila_2:1624891_at:232:103; Interrogation_Position=2015; Antisense; AGAGCCCACGATAAGCGCACGGAGA
>probe:Drosophila_2:1624891_at:212:297; Interrogation_Position=2030; Antisense; CGCACGGAGAGTTTGGCTGAGATTC

Paste this into a BLAST search page for me
AAATGTCCCTCTGGGATGCACGTAGTGCACGTAGTCTGATCAGCGCACATATGAATGATCACTTTGGCTGGCCCTGGCTGGCCCTAATTTATTCATCGTCATTCATCGTCTAGCGTTAATTCTAAAAAGCCTACGATTAAGTTTGGTCAGTCATCGATTCACTGGATCACTGTGGATCACTGTGGAGTGCATTTCGCTCAGTGCATTTCGCTCAGTTTTGTGATACAGCCATTTAGCGTACGTCACTTAAACGCACTAACTCTAATTAACCGCAGGAGAGAATGTCCTAGAGCCCACGATAGAGCCCACGATAAGCGCACGGAGACGCACGGAGAGTTTGGCTGAGATTC

Full Affymetrix probeset data:

Annotations for 1624891_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720