Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624893_at:

>probe:Drosophila_2:1624893_at:568:587; Interrogation_Position=1828; Antisense; TGGAGGTACCTCGATTTGCAATTGC
>probe:Drosophila_2:1624893_at:241:693; Interrogation_Position=1842; Antisense; TTTGCAATTGCACTGGTCACAGAGA
>probe:Drosophila_2:1624893_at:591:153; Interrogation_Position=1860; Antisense; ACAGAGAATCCACCTGCTCGAGGAC
>probe:Drosophila_2:1624893_at:593:435; Interrogation_Position=1879; Antisense; GAGGACCCATCATGTCACCTACGAG
>probe:Drosophila_2:1624893_at:273:669; Interrogation_Position=1898; Antisense; TACGAGTCCTTACCAGCTGAGCTGC
>probe:Drosophila_2:1624893_at:15:609; Interrogation_Position=1915; Antisense; TGAGCTGCCCTATCAACTGTACGCA
>probe:Drosophila_2:1624893_at:555:453; Interrogation_Position=2021; Antisense; GATCATCTGTCGTTTGTGGAGGAGA
>probe:Drosophila_2:1624893_at:245:675; Interrogation_Position=2073; Antisense; TATCCTAGGTTTGTCTTTGAATACG
>probe:Drosophila_2:1624893_at:728:475; Interrogation_Position=2138; Antisense; GTTTAAGGTCGCACAACAGCAAAGG
>probe:Drosophila_2:1624893_at:269:539; Interrogation_Position=2161; Antisense; GGTACTGCTGGTTACACCTAGGGTA
>probe:Drosophila_2:1624893_at:212:111; Interrogation_Position=2269; Antisense; AGAATAAAGTCTCTGCACCCTGATT
>probe:Drosophila_2:1624893_at:170:131; Interrogation_Position=2285; Antisense; ACCCTGATTTGCTGTGCCCTGCGTT
>probe:Drosophila_2:1624893_at:685:625; Interrogation_Position=2299; Antisense; TGCCCTGCGTTGTTATTATTTGTTA
>probe:Drosophila_2:1624893_at:117:271; Interrogation_Position=2381; Antisense; CATAATTGGTTTACGAGAGCTCACA

Paste this into a BLAST search page for me
TGGAGGTACCTCGATTTGCAATTGCTTTGCAATTGCACTGGTCACAGAGAACAGAGAATCCACCTGCTCGAGGACGAGGACCCATCATGTCACCTACGAGTACGAGTCCTTACCAGCTGAGCTGCTGAGCTGCCCTATCAACTGTACGCAGATCATCTGTCGTTTGTGGAGGAGATATCCTAGGTTTGTCTTTGAATACGGTTTAAGGTCGCACAACAGCAAAGGGGTACTGCTGGTTACACCTAGGGTAAGAATAAAGTCTCTGCACCCTGATTACCCTGATTTGCTGTGCCCTGCGTTTGCCCTGCGTTGTTATTATTTGTTACATAATTGGTTTACGAGAGCTCACA

Full Affymetrix probeset data:

Annotations for 1624893_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime