Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624894_s_at:

>probe:Drosophila_2:1624894_s_at:488:73; Interrogation_Position=180; Antisense; AGGAACTGATCCAGCTGAACCTGCT
>probe:Drosophila_2:1624894_s_at:703:613; Interrogation_Position=195; Antisense; TGAACCTGCTCAATATTGCCCTGCA
>probe:Drosophila_2:1624894_s_at:60:193; Interrogation_Position=227; Antisense; AACTATGCCGATTTCTTCAAACACA
>probe:Drosophila_2:1624894_s_at:684:217; Interrogation_Position=278; Antisense; AAGTCACCTGTGGAGGATCTTCTAA
>probe:Drosophila_2:1624894_s_at:146:595; Interrogation_Position=333; Antisense; TGGGCAGCGCATATATGTCCATTTA
>probe:Drosophila_2:1624894_s_at:453:555; Interrogation_Position=394; Antisense; GGACGAACTGAAACACGCCTGTGCG
>probe:Drosophila_2:1624894_s_at:234:315; Interrogation_Position=410; Antisense; GCCTGTGCGGCCTTAAATTGGACTG
>probe:Drosophila_2:1624894_s_at:125:511; Interrogation_Position=447; Antisense; GTGACCGGGTAATCCTGAAGCCCAA
>probe:Drosophila_2:1624894_s_at:415:73; Interrogation_Position=477; Antisense; AGGAAGCACCGCCAGCTCGTGGAAA
>probe:Drosophila_2:1624894_s_at:536:413; Interrogation_Position=506; Antisense; GACCAGTTGCTTAAGTTGACCGAGT
>probe:Drosophila_2:1624894_s_at:4:413; Interrogation_Position=523; Antisense; GACCGAGTTTGTAACCTTCCTAGAG
>probe:Drosophila_2:1624894_s_at:175:387; Interrogation_Position=603; Antisense; GAAAAGTTATGGTCACACAGCCTGT
>probe:Drosophila_2:1624894_s_at:422:339; Interrogation_Position=683; Antisense; GCTAAATCACCGAATTGGCGCCATT
>probe:Drosophila_2:1624894_s_at:644:581; Interrogation_Position=698; Antisense; TGGCGCCATTGGGTTTTGTACGAAT

Paste this into a BLAST search page for me
AGGAACTGATCCAGCTGAACCTGCTTGAACCTGCTCAATATTGCCCTGCAAACTATGCCGATTTCTTCAAACACAAAGTCACCTGTGGAGGATCTTCTAATGGGCAGCGCATATATGTCCATTTAGGACGAACTGAAACACGCCTGTGCGGCCTGTGCGGCCTTAAATTGGACTGGTGACCGGGTAATCCTGAAGCCCAAAGGAAGCACCGCCAGCTCGTGGAAAGACCAGTTGCTTAAGTTGACCGAGTGACCGAGTTTGTAACCTTCCTAGAGGAAAAGTTATGGTCACACAGCCTGTGCTAAATCACCGAATTGGCGCCATTTGGCGCCATTGGGTTTTGTACGAAT

Full Affymetrix probeset data:

Annotations for 1624894_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime