FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624895_at:

>probe:Drosophila_2:1624895_at:28:269; Interrogation_Position=1243; Antisense; CAGGCGCTTAACAGTCATGATCATA
>probe:Drosophila_2:1624895_at:230:25; Interrogation_Position=1265; Antisense; ATAGTGCAGCAGTGTCCTCGTACTT
>probe:Drosophila_2:1624895_at:485:637; Interrogation_Position=1289; Antisense; TCGATCTCACTACGAACATCTTCAT
>probe:Drosophila_2:1624895_at:492:613; Interrogation_Position=1313; Antisense; TGAAGTCCCCGGTAATAACTCTGGC
>probe:Drosophila_2:1624895_at:316:301; Interrogation_Position=1367; Antisense; CGCCAGTTTACGTCTACAGTTTTGA
>probe:Drosophila_2:1624895_at:318:635; Interrogation_Position=1435; Antisense; TCGCACTATCCCTTCAATGGAGGAG
>probe:Drosophila_2:1624895_at:519:431; Interrogation_Position=1457; Antisense; GAGTGCATCACTCGAACGACAACAT
>probe:Drosophila_2:1624895_at:264:63; Interrogation_Position=1544; Antisense; ATGTGTGGACTTCATTTGCCATCGA
>probe:Drosophila_2:1624895_at:304:19; Interrogation_Position=1557; Antisense; ATTTGCCATCGAAGGTGTTCCCAGA
>probe:Drosophila_2:1624895_at:639:513; Interrogation_Position=1571; Antisense; GTGTTCCCAGAAATCTTAGTCCGCT
>probe:Drosophila_2:1624895_at:709:485; Interrogation_Position=1598; Antisense; GTAGCGCAAGTGGTCCGTATAACAA
>probe:Drosophila_2:1624895_at:356:603; Interrogation_Position=1655; Antisense; TGTTGGACACTTTAACTGCCGCTAT
>probe:Drosophila_2:1624895_at:130:627; Interrogation_Position=1671; Antisense; TGCCGCTATTGACGATCCTGACAAT
>probe:Drosophila_2:1624895_at:670:549; Interrogation_Position=1719; Antisense; GGAGTTTTAATAGCCACCATTCGAC

Paste this into a BLAST search page for me
CAGGCGCTTAACAGTCATGATCATAATAGTGCAGCAGTGTCCTCGTACTTTCGATCTCACTACGAACATCTTCATTGAAGTCCCCGGTAATAACTCTGGCCGCCAGTTTACGTCTACAGTTTTGATCGCACTATCCCTTCAATGGAGGAGGAGTGCATCACTCGAACGACAACATATGTGTGGACTTCATTTGCCATCGAATTTGCCATCGAAGGTGTTCCCAGAGTGTTCCCAGAAATCTTAGTCCGCTGTAGCGCAAGTGGTCCGTATAACAATGTTGGACACTTTAACTGCCGCTATTGCCGCTATTGACGATCCTGACAATGGAGTTTTAATAGCCACCATTCGAC

Full Affymetrix probeset data:

Annotations for 1624895_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720