FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624897_at:

>probe:Drosophila_2:1624897_at:611:507; Interrogation_Position=450; Antisense; GTGCGAAGCTCGTTGGCTTTCACAA
>probe:Drosophila_2:1624897_at:688:175; Interrogation_Position=473; Antisense; AAACGCGGCCATCCGATTTCAGGCG
>probe:Drosophila_2:1624897_at:644:119; Interrogation_Position=517; Antisense; AGCTGCAGTGCAATATGGACGATCA
>probe:Drosophila_2:1624897_at:374:409; Interrogation_Position=534; Antisense; GACGATCACTACCTATTCATGCGGA
>probe:Drosophila_2:1624897_at:526:561; Interrogation_Position=556; Antisense; GGAACACCATGATCAACAACGCTAT
>probe:Drosophila_2:1624897_at:379:363; Interrogation_Position=587; Antisense; GAATATGGCCAACCAACGGTGACCC
>probe:Drosophila_2:1624897_at:336:479; Interrogation_Position=687; Antisense; GTTTGCTTTTGGCTTATACAGTATA
>probe:Drosophila_2:1624897_at:384:245; Interrogation_Position=711; Antisense; AATTCGCTTAGCTGCCTCGAGTACT
>probe:Drosophila_2:1624897_at:247:431; Interrogation_Position=729; Antisense; GAGTACTTTGCACAATGCCTCGATG
>probe:Drosophila_2:1624897_at:88:249; Interrogation_Position=741; Antisense; CAATGCCTCGATGCAGGTAACTTAA
>probe:Drosophila_2:1624897_at:293:459; Interrogation_Position=840; Antisense; GATATCTTGCCGATGCAGCTAACTA
>probe:Drosophila_2:1624897_at:160:493; Interrogation_Position=912; Antisense; GTAACTCCCTAAGTTGCACTTCTGA
>probe:Drosophila_2:1624897_at:281:725; Interrogation_Position=925; Antisense; TTGCACTTCTGATGATGGCTGCCTT
>probe:Drosophila_2:1624897_at:292:67; Interrogation_Position=939; Antisense; ATGGCTGCCTTTAAGTCTGACCGAA

Paste this into a BLAST search page for me
GTGCGAAGCTCGTTGGCTTTCACAAAAACGCGGCCATCCGATTTCAGGCGAGCTGCAGTGCAATATGGACGATCAGACGATCACTACCTATTCATGCGGAGGAACACCATGATCAACAACGCTATGAATATGGCCAACCAACGGTGACCCGTTTGCTTTTGGCTTATACAGTATAAATTCGCTTAGCTGCCTCGAGTACTGAGTACTTTGCACAATGCCTCGATGCAATGCCTCGATGCAGGTAACTTAAGATATCTTGCCGATGCAGCTAACTAGTAACTCCCTAAGTTGCACTTCTGATTGCACTTCTGATGATGGCTGCCTTATGGCTGCCTTTAAGTCTGACCGAA

Full Affymetrix probeset data:

Annotations for 1624897_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720