FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624899_at:

>probe:Drosophila_2:1624899_at:226:601; Interrogation_Position=1399; Antisense; TGTAACTGCCTTGGTTCAGCTGCTA
>probe:Drosophila_2:1624899_at:119:649; Interrogation_Position=1414; Antisense; TCAGCTGCTATATCCGTTTGTTTTC
>probe:Drosophila_2:1624899_at:719:45; Interrogation_Position=1425; Antisense; ATCCGTTTGTTTTCAACCAGCACTT
>probe:Drosophila_2:1624899_at:461:203; Interrogation_Position=1439; Antisense; AACCAGCACTTAACTTGATTCTATG
>probe:Drosophila_2:1624899_at:421:489; Interrogation_Position=1470; Antisense; GTACTTCAACAGATACTCCGTGCTT
>probe:Drosophila_2:1624899_at:488:155; Interrogation_Position=1534; Antisense; ACAGCCCTGTTATCTATTGGTTTCA
>probe:Drosophila_2:1624899_at:439:689; Interrogation_Position=1548; Antisense; TATTGGTTTCAACCCGACAGTCATA
>probe:Drosophila_2:1624899_at:27:59; Interrogation_Position=1578; Antisense; ATGTAATCTTTTTTCGCACACACGC
>probe:Drosophila_2:1624899_at:430:259; Interrogation_Position=1598; Antisense; CACGCACGAGCAGAATTCCATTAGT
>probe:Drosophila_2:1624899_at:439:659; Interrogation_Position=1657; Antisense; TAAGCTCACAGCAACTTTCGCACAA
>probe:Drosophila_2:1624899_at:97:431; Interrogation_Position=1684; Antisense; GAGTAAATTCGCTAGCCCCAAACTA
>probe:Drosophila_2:1624899_at:257:157; Interrogation_Position=1726; Antisense; ACACATATCTGTGGTGCTACGATGA
>probe:Drosophila_2:1624899_at:396:93; Interrogation_Position=1770; Antisense; AGTTCTTGAGATTTGCCTTTCTTTC
>probe:Drosophila_2:1624899_at:618:305; Interrogation_Position=1785; Antisense; CCTTTCTTTCTACTTACCATACTGA

Paste this into a BLAST search page for me
TGTAACTGCCTTGGTTCAGCTGCTATCAGCTGCTATATCCGTTTGTTTTCATCCGTTTGTTTTCAACCAGCACTTAACCAGCACTTAACTTGATTCTATGGTACTTCAACAGATACTCCGTGCTTACAGCCCTGTTATCTATTGGTTTCATATTGGTTTCAACCCGACAGTCATAATGTAATCTTTTTTCGCACACACGCCACGCACGAGCAGAATTCCATTAGTTAAGCTCACAGCAACTTTCGCACAAGAGTAAATTCGCTAGCCCCAAACTAACACATATCTGTGGTGCTACGATGAAGTTCTTGAGATTTGCCTTTCTTTCCCTTTCTTTCTACTTACCATACTGA

Full Affymetrix probeset data:

Annotations for 1624899_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720