FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624900_at:

>probe:Drosophila_2:1624900_at:423:193; Interrogation_Position=307; Antisense; AACTACACTCAGTTTCAGGCGGAGC
>probe:Drosophila_2:1624900_at:652:419; Interrogation_Position=328; Antisense; GAGCAGGCTACCAAGACGCAGTCGT
>probe:Drosophila_2:1624900_at:603:87; Interrogation_Position=347; Antisense; AGTCGTCCACTCTGATACCAATCAA
>probe:Drosophila_2:1624900_at:538:323; Interrogation_Position=389; Antisense; GCGAGCCGGAACACAAGCCACTGGT
>probe:Drosophila_2:1624900_at:207:127; Interrogation_Position=404; Antisense; AGCCACTGGTGGACTACAAATCCGA
>probe:Drosophila_2:1624900_at:458:235; Interrogation_Position=422; Antisense; AATCCGAGAGTAGCGACGAGGCCGA
>probe:Drosophila_2:1624900_at:552:437; Interrogation_Position=439; Antisense; GAGGCCGAGGAGATCTCCTTCTTTC
>probe:Drosophila_2:1624900_at:153:109; Interrogation_Position=497; Antisense; AGAACCACGAACTGACTGACACCTT
>probe:Drosophila_2:1624900_at:220:283; Interrogation_Position=512; Antisense; CTGACACCTTCAGCATACAGGAGAT
>probe:Drosophila_2:1624900_at:249:99; Interrogation_Position=533; Antisense; AGATGACCATTGACTCGGATCTGGA
>probe:Drosophila_2:1624900_at:139:429; Interrogation_Position=556; Antisense; GAGTCGGACGACAGTGCTGGCACCC
>probe:Drosophila_2:1624900_at:636:375; Interrogation_Position=609; Antisense; GAAGACGACCATTCTGGACAAGTTT
>probe:Drosophila_2:1624900_at:508:697; Interrogation_Position=631; Antisense; TTTAAGGGATGCTTCGGATGCTGGC
>probe:Drosophila_2:1624900_at:146:621; Interrogation_Position=87; Antisense; TGCGGGACTCTTGAAAACGGCCAGC

Paste this into a BLAST search page for me
AACTACACTCAGTTTCAGGCGGAGCGAGCAGGCTACCAAGACGCAGTCGTAGTCGTCCACTCTGATACCAATCAAGCGAGCCGGAACACAAGCCACTGGTAGCCACTGGTGGACTACAAATCCGAAATCCGAGAGTAGCGACGAGGCCGAGAGGCCGAGGAGATCTCCTTCTTTCAGAACCACGAACTGACTGACACCTTCTGACACCTTCAGCATACAGGAGATAGATGACCATTGACTCGGATCTGGAGAGTCGGACGACAGTGCTGGCACCCGAAGACGACCATTCTGGACAAGTTTTTTAAGGGATGCTTCGGATGCTGGCTGCGGGACTCTTGAAAACGGCCAGC

Full Affymetrix probeset data:

Annotations for 1624900_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720