Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624901_at:

>probe:Drosophila_2:1624901_at:72:111; Interrogation_Position=1008; Antisense; AGCAAACCCGTGTGGCGTTGGAGAA
>probe:Drosophila_2:1624901_at:253:281; Interrogation_Position=1049; Antisense; CTCTGGTCAGAGGTCAATCATTTGT
>probe:Drosophila_2:1624901_at:275:19; Interrogation_Position=1065; Antisense; ATCATTTGTTCGTGGGATTCGGACA
>probe:Drosophila_2:1624901_at:64:397; Interrogation_Position=1086; Antisense; GACAAACCATTTGCACCCCAGTGAA
>probe:Drosophila_2:1624901_at:666:225; Interrogation_Position=1136; Antisense; AAGGACATTTGTCCTTCAGCCCATG
>probe:Drosophila_2:1624901_at:60:399; Interrogation_Position=607; Antisense; GACCCAGCGCTTCCAAAACTTAGTG
>probe:Drosophila_2:1624901_at:232:521; Interrogation_Position=629; Antisense; GTGGCATTGATGCTGTCCAGTCAAA
>probe:Drosophila_2:1624901_at:669:377; Interrogation_Position=674; Antisense; GAAGCCATGAATCGCCTTAAAGACC
>probe:Drosophila_2:1624901_at:301:211; Interrogation_Position=693; Antisense; AAGACCGAGGTCTAACTCCACTGAA
>probe:Drosophila_2:1624901_at:436:157; Interrogation_Position=741; Antisense; AACTCGAGAATTTACTGCATCCCGT
>probe:Drosophila_2:1624901_at:395:619; Interrogation_Position=756; Antisense; TGCATCCCGTATCCTTCTACAAGAA
>probe:Drosophila_2:1624901_at:385:225; Interrogation_Position=854; Antisense; AAGGACCTTGTAGCTCTTCCAGGAG
>probe:Drosophila_2:1624901_at:206:93; Interrogation_Position=877; Antisense; AGTTGGCCCCAAGATGGCCCATATA
>probe:Drosophila_2:1624901_at:554:653; Interrogation_Position=927; Antisense; TAACCGGAATCGGAGTGGACGTCCA

Paste this into a BLAST search page for me
AGCAAACCCGTGTGGCGTTGGAGAACTCTGGTCAGAGGTCAATCATTTGTATCATTTGTTCGTGGGATTCGGACAGACAAACCATTTGCACCCCAGTGAAAAGGACATTTGTCCTTCAGCCCATGGACCCAGCGCTTCCAAAACTTAGTGGTGGCATTGATGCTGTCCAGTCAAAGAAGCCATGAATCGCCTTAAAGACCAAGACCGAGGTCTAACTCCACTGAAAACTCGAGAATTTACTGCATCCCGTTGCATCCCGTATCCTTCTACAAGAAAAGGACCTTGTAGCTCTTCCAGGAGAGTTGGCCCCAAGATGGCCCATATATAACCGGAATCGGAGTGGACGTCCA

Full Affymetrix probeset data:

Annotations for 1624901_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime