Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624902_at:

>probe:Drosophila_2:1624902_at:560:373; Interrogation_Position=1198; Antisense; GAAGATAACCGAGCGCTTGGGAGAT
>probe:Drosophila_2:1624902_at:35:327; Interrogation_Position=1223; Antisense; GCGACTGGGCTGGACATGAACTCTA
>probe:Drosophila_2:1624902_at:523:145; Interrogation_Position=1242; Antisense; ACTCTACGGAGTTCTATCAGGTCAT
>probe:Drosophila_2:1624902_at:469:25; Interrogation_Position=1257; Antisense; ATCAGGTCATTAACTACGGGCTAGG
>probe:Drosophila_2:1624902_at:144:541; Interrogation_Position=1283; Antisense; GGTTTCTTCGAGACGCATTTGGACA
>probe:Drosophila_2:1624902_at:693:379; Interrogation_Position=1338; Antisense; GAACCAGTGATCGTATTGCCACCAC
>probe:Drosophila_2:1624902_at:337:645; Interrogation_Position=1372; Antisense; TCTTAATGAAGTTCGCCAGGGCGGC
>probe:Drosophila_2:1624902_at:266:635; Interrogation_Position=1411; Antisense; TCGACTAAATCTCACGGTATTCCCA
>probe:Drosophila_2:1624902_at:169:39; Interrogation_Position=1444; Antisense; ATCGGCCCTCTTTTGGTATAACTTG
>probe:Drosophila_2:1624902_at:140:493; Interrogation_Position=1479; Antisense; GTAACGATCATATGGGTTCCCTGCA
>probe:Drosophila_2:1624902_at:663:623; Interrogation_Position=1511; Antisense; TGCCCGGTCATCGTGGGTTCCAAAT
>probe:Drosophila_2:1624902_at:186:217; Interrogation_Position=1579; Antisense; AAGGCCCTGTGTCGAGTCAAGTTTA
>probe:Drosophila_2:1624902_at:510:435; Interrogation_Position=1613; Antisense; GAGGTGTTATCAGCTGAGCGGCTTA
>probe:Drosophila_2:1624902_at:502:257; Interrogation_Position=1770; Antisense; CACTTCTGCTTTGATTGGTGCGAGC

Paste this into a BLAST search page for me
GAAGATAACCGAGCGCTTGGGAGATGCGACTGGGCTGGACATGAACTCTAACTCTACGGAGTTCTATCAGGTCATATCAGGTCATTAACTACGGGCTAGGGGTTTCTTCGAGACGCATTTGGACAGAACCAGTGATCGTATTGCCACCACTCTTAATGAAGTTCGCCAGGGCGGCTCGACTAAATCTCACGGTATTCCCAATCGGCCCTCTTTTGGTATAACTTGGTAACGATCATATGGGTTCCCTGCATGCCCGGTCATCGTGGGTTCCAAATAAGGCCCTGTGTCGAGTCAAGTTTAGAGGTGTTATCAGCTGAGCGGCTTACACTTCTGCTTTGATTGGTGCGAGC

Full Affymetrix probeset data:

Annotations for 1624902_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime