FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624903_at:

>probe:Drosophila_2:1624903_at:567:573; Interrogation_Position=1027; Antisense; GGCGATGAGGTCGACAATCCGCACT
>probe:Drosophila_2:1624903_at:701:535; Interrogation_Position=1100; Antisense; GGTGCCATCAGGAGCATGTCCTCAA
>probe:Drosophila_2:1624903_at:197:63; Interrogation_Position=1115; Antisense; ATGTCCTCAATCTGTGCAAGTGCTC
>probe:Drosophila_2:1624903_at:20:639; Interrogation_Position=1144; Antisense; TCGATCTTTTTTCCCATCTCAGATA
>probe:Drosophila_2:1624903_at:674:345; Interrogation_Position=1183; Antisense; GCATGCAAAGCCTCAGACTTCAAGT
>probe:Drosophila_2:1624903_at:233:291; Interrogation_Position=1229; Antisense; CCTTTAGCATTGAACGGCATCCCGA
>probe:Drosophila_2:1624903_at:24:617; Interrogation_Position=1315; Antisense; TGCAGTCAGCTGGTTTTCGACCGGG
>probe:Drosophila_2:1624903_at:605:701; Interrogation_Position=1340; Antisense; TTTTCACTACTACCACGCTTGAGTA
>probe:Drosophila_2:1624903_at:56:377; Interrogation_Position=769; Antisense; GAAGACAAATATTACCCGCTCCGCA
>probe:Drosophila_2:1624903_at:365:589; Interrogation_Position=821; Antisense; TGGATCTCTTTCTGCGGCTCAACAG
>probe:Drosophila_2:1624903_at:684:95; Interrogation_Position=844; Antisense; AGATCCTTCATTCGACCTGGAAAGC
>probe:Drosophila_2:1624903_at:78:231; Interrogation_Position=877; Antisense; AATGTGATGATCAAGCAGCCGCAGC
>probe:Drosophila_2:1624903_at:148:151; Interrogation_Position=930; Antisense; ACATGAGGCGCACACCAGGATTAGC
>probe:Drosophila_2:1624903_at:655:75; Interrogation_Position=946; Antisense; AGGATTAGCATAACACCCCGTTTCA

Paste this into a BLAST search page for me
GGCGATGAGGTCGACAATCCGCACTGGTGCCATCAGGAGCATGTCCTCAAATGTCCTCAATCTGTGCAAGTGCTCTCGATCTTTTTTCCCATCTCAGATAGCATGCAAAGCCTCAGACTTCAAGTCCTTTAGCATTGAACGGCATCCCGATGCAGTCAGCTGGTTTTCGACCGGGTTTTCACTACTACCACGCTTGAGTAGAAGACAAATATTACCCGCTCCGCATGGATCTCTTTCTGCGGCTCAACAGAGATCCTTCATTCGACCTGGAAAGCAATGTGATGATCAAGCAGCCGCAGCACATGAGGCGCACACCAGGATTAGCAGGATTAGCATAACACCCCGTTTCA

Full Affymetrix probeset data:

Annotations for 1624903_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720