FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624905_at:

>probe:Drosophila_2:1624905_at:501:35; Interrogation_Position=1040; Antisense; ATCATGCAGGTTCATCTCTTTCTGA
>probe:Drosophila_2:1624905_at:636:597; Interrogation_Position=1084; Antisense; TGTCTTCAAGTATCCACCATTCTAC
>probe:Drosophila_2:1624905_at:334:5; Interrogation_Position=1102; Antisense; ATTCTACGTGGCCATGGGATTCCAA
>probe:Drosophila_2:1624905_at:485:11; Interrogation_Position=1142; Antisense; ATTCTCGTCGGTTTGCTAATCGTCT
>probe:Drosophila_2:1624905_at:581:653; Interrogation_Position=1158; Antisense; TAATCGTCTTTACCTACGTACTCGC
>probe:Drosophila_2:1624905_at:198:613; Interrogation_Position=1200; Antisense; TGAACTTCGCCATGACAATTTTGTC
>probe:Drosophila_2:1624905_at:115:245; Interrogation_Position=1216; Antisense; AATTTTGTCGCGACGATTCGAGTAT
>probe:Drosophila_2:1624905_at:503:35; Interrogation_Position=1239; Antisense; ATCAGGCTGATGAGTTCGCTTTCAA
>probe:Drosophila_2:1624905_at:381:351; Interrogation_Position=1279; Antisense; GCAGTTGGGTCAGGCCCTCATAAAA
>probe:Drosophila_2:1624905_at:724:341; Interrogation_Position=1323; Antisense; GCTTCCCCGTTTACGATTGGCTGTA
>probe:Drosophila_2:1624905_at:11:467; Interrogation_Position=1337; Antisense; GATTGGCTGTACTCGACTTGGAACC
>probe:Drosophila_2:1624905_at:246:629; Interrogation_Position=1380; Antisense; TCCAGCGCCTGAATCGACTCAAGGA
>probe:Drosophila_2:1624905_at:612:475; Interrogation_Position=983; Antisense; GTTTTGGGACACGAGCTGGGACACT
>probe:Drosophila_2:1624905_at:386:593; Interrogation_Position=999; Antisense; TGGGACACTGGAAACTGGGACACGT

Paste this into a BLAST search page for me
ATCATGCAGGTTCATCTCTTTCTGATGTCTTCAAGTATCCACCATTCTACATTCTACGTGGCCATGGGATTCCAAATTCTCGTCGGTTTGCTAATCGTCTTAATCGTCTTTACCTACGTACTCGCTGAACTTCGCCATGACAATTTTGTCAATTTTGTCGCGACGATTCGAGTATATCAGGCTGATGAGTTCGCTTTCAAGCAGTTGGGTCAGGCCCTCATAAAAGCTTCCCCGTTTACGATTGGCTGTAGATTGGCTGTACTCGACTTGGAACCTCCAGCGCCTGAATCGACTCAAGGAGTTTTGGGACACGAGCTGGGACACTTGGGACACTGGAAACTGGGACACGT

Full Affymetrix probeset data:

Annotations for 1624905_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720