Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624906_at:

>probe:Drosophila_2:1624906_at:575:641; Interrogation_Position=110; Antisense; TCTTGAGGTCGAACCGTCGGATACT
>probe:Drosophila_2:1624906_at:338:355; Interrogation_Position=229; Antisense; GCACCCTCTCTGACTATAACATTCA
>probe:Drosophila_2:1624906_at:461:109; Interrogation_Position=310; Antisense; AGAAGAAGAACTACTCCACTCCCAA
>probe:Drosophila_2:1624906_at:216:279; Interrogation_Position=320; Antisense; CTACTCCACTCCCAAGAAAATCAAG
>probe:Drosophila_2:1624906_at:489:465; Interrogation_Position=35; Antisense; GTTGCCGAAGCAAGTTTGGTGACTG
>probe:Drosophila_2:1624906_at:338:371; Interrogation_Position=356; Antisense; GAAGGTCAAGCTAGCTGTCCTGAAA
>probe:Drosophila_2:1624906_at:213:423; Interrogation_Position=396; Antisense; GAGAACGGCAAGATCCACCGTCTCC
>probe:Drosophila_2:1624906_at:453:633; Interrogation_Position=422; Antisense; TCGCGAGTGCCCTGGTGAGAACTGC
>probe:Drosophila_2:1624906_at:15:713; Interrogation_Position=459; Antisense; TTCATGGCTGCCCACGAAGATCGTC
>probe:Drosophila_2:1624906_at:320:375; Interrogation_Position=474; Antisense; GAAGATCGTCACTACTGCGGCAAGT
>probe:Drosophila_2:1624906_at:31:331; Interrogation_Position=490; Antisense; GCGGCAAGTGCAACCTGACCTTTGT
>probe:Drosophila_2:1624906_at:177:413; Interrogation_Position=506; Antisense; GACCTTTGTCTTCAGCAAACCAGAG
>probe:Drosophila_2:1624906_at:106:33; Interrogation_Position=549; Antisense; ATAAGATCATGTACGTTTCCAGAAA
>probe:Drosophila_2:1624906_at:218:527; Interrogation_Position=95; Antisense; GGGCAAGACCATCACTCTTGAGGTC

Paste this into a BLAST search page for me
TCTTGAGGTCGAACCGTCGGATACTGCACCCTCTCTGACTATAACATTCAAGAAGAAGAACTACTCCACTCCCAACTACTCCACTCCCAAGAAAATCAAGGTTGCCGAAGCAAGTTTGGTGACTGGAAGGTCAAGCTAGCTGTCCTGAAAGAGAACGGCAAGATCCACCGTCTCCTCGCGAGTGCCCTGGTGAGAACTGCTTCATGGCTGCCCACGAAGATCGTCGAAGATCGTCACTACTGCGGCAAGTGCGGCAAGTGCAACCTGACCTTTGTGACCTTTGTCTTCAGCAAACCAGAGATAAGATCATGTACGTTTCCAGAAAGGGCAAGACCATCACTCTTGAGGTC

Full Affymetrix probeset data:

Annotations for 1624906_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime