FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624907_at:

>probe:Drosophila_2:1624907_at:401:457; Interrogation_Position=1014; Antisense; GATATCCTATGTATTTCTGGTAAAA
>probe:Drosophila_2:1624907_at:330:647; Interrogation_Position=1040; Antisense; TCATGTTATACCTATCGAACGAACG
>probe:Drosophila_2:1624907_at:485:725; Interrogation_Position=1108; Antisense; TTGTTAAACCGAATCCCCACACATT
>probe:Drosophila_2:1624907_at:387:195; Interrogation_Position=1191; Antisense; AACTGTTGAGAGTCCCAATGCGAAA
>probe:Drosophila_2:1624907_at:622:217; Interrogation_Position=1267; Antisense; AAGTACATTGTTCATTCGATTCATA
>probe:Drosophila_2:1624907_at:4:379; Interrogation_Position=1331; Antisense; GAAGCGTCAATAATCGAGAGCTCGA
>probe:Drosophila_2:1624907_at:238:295; Interrogation_Position=1345; Antisense; CGAGAGCTCGAATTGCATAAGAAAT
>probe:Drosophila_2:1624907_at:198:81; Interrogation_Position=809; Antisense; AGGTGTATCCATCAACTACATCTAG
>probe:Drosophila_2:1624907_at:382:193; Interrogation_Position=822; Antisense; AACTACATCTAGAGGCACACCCACA
>probe:Drosophila_2:1624907_at:275:157; Interrogation_Position=860; Antisense; ACACCTCACATTCTCATTAACTTTT
>probe:Drosophila_2:1624907_at:29:661; Interrogation_Position=877; Antisense; TAACTTTTACAGTCGTTGAACGCAC
>probe:Drosophila_2:1624907_at:465:723; Interrogation_Position=892; Antisense; TTGAACGCACATACACAACGGGATA
>probe:Drosophila_2:1624907_at:41:197; Interrogation_Position=908; Antisense; AACGGGATACACAATAACACCTTGA
>probe:Drosophila_2:1624907_at:409:231; Interrogation_Position=999; Antisense; AATGCTTACATTTTTGATATCCTAT

Paste this into a BLAST search page for me
GATATCCTATGTATTTCTGGTAAAATCATGTTATACCTATCGAACGAACGTTGTTAAACCGAATCCCCACACATTAACTGTTGAGAGTCCCAATGCGAAAAAGTACATTGTTCATTCGATTCATAGAAGCGTCAATAATCGAGAGCTCGACGAGAGCTCGAATTGCATAAGAAATAGGTGTATCCATCAACTACATCTAGAACTACATCTAGAGGCACACCCACAACACCTCACATTCTCATTAACTTTTTAACTTTTACAGTCGTTGAACGCACTTGAACGCACATACACAACGGGATAAACGGGATACACAATAACACCTTGAAATGCTTACATTTTTGATATCCTAT

Full Affymetrix probeset data:

Annotations for 1624907_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720