FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624908_at:

>probe:Drosophila_2:1624908_at:657:587; Interrogation_Position=4290; Antisense; TGGAGATTCCTGCACAACTGGCCAA
>probe:Drosophila_2:1624908_at:383:157; Interrogation_Position=4303; Antisense; ACAACTGGCCAACACGGATCGGATA
>probe:Drosophila_2:1624908_at:405:545; Interrogation_Position=4318; Antisense; GGATCGGATACACCAGTTCGTTTCT
>probe:Drosophila_2:1624908_at:559:15; Interrogation_Position=4394; Antisense; ATTATGTTTCATCTCTATCCGCGAC
>probe:Drosophila_2:1624908_at:377:45; Interrogation_Position=4410; Antisense; ATCCGCGACTGCAGCTTTTGGTTCA
>probe:Drosophila_2:1624908_at:513:165; Interrogation_Position=4477; Antisense; AAATCGCCGGCGCATGTTTATAGAA
>probe:Drosophila_2:1624908_at:441:387; Interrogation_Position=4499; Antisense; GAACAACAGCGCTTTAGCCTCTATA
>probe:Drosophila_2:1624908_at:501:117; Interrogation_Position=4553; Antisense; AGCTACTTTCAGTTCAAGGACCAGT
>probe:Drosophila_2:1624908_at:700:413; Interrogation_Position=4571; Antisense; GACCAGTTCAACTCGCATGTGCGTA
>probe:Drosophila_2:1624908_at:601:507; Interrogation_Position=4589; Antisense; GTGCGTAACATCGAGTTCTTCCAGT
>probe:Drosophila_2:1624908_at:574:93; Interrogation_Position=4602; Antisense; AGTTCTTCCAGTTCATGACATCCAA
>probe:Drosophila_2:1624908_at:361:199; Interrogation_Position=4631; Antisense; AACGAGAAGACGCATCCCGATGATA
>probe:Drosophila_2:1624908_at:15:87; Interrogation_Position=4682; Antisense; AGTCCGTCAATCAAGCCCAAATTCA
>probe:Drosophila_2:1624908_at:144:63; Interrogation_Position=4717; Antisense; ATGTGTTTGTCCCAAGTACCTCAAG

Paste this into a BLAST search page for me
TGGAGATTCCTGCACAACTGGCCAAACAACTGGCCAACACGGATCGGATAGGATCGGATACACCAGTTCGTTTCTATTATGTTTCATCTCTATCCGCGACATCCGCGACTGCAGCTTTTGGTTCAAAATCGCCGGCGCATGTTTATAGAAGAACAACAGCGCTTTAGCCTCTATAAGCTACTTTCAGTTCAAGGACCAGTGACCAGTTCAACTCGCATGTGCGTAGTGCGTAACATCGAGTTCTTCCAGTAGTTCTTCCAGTTCATGACATCCAAAACGAGAAGACGCATCCCGATGATAAGTCCGTCAATCAAGCCCAAATTCAATGTGTTTGTCCCAAGTACCTCAAG

Full Affymetrix probeset data:

Annotations for 1624908_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720