Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624910_at:

>probe:Drosophila_2:1624910_at:586:481; Interrogation_Position=1561; Antisense; GTATTTCTGAAACAGGGCCACGCCC
>probe:Drosophila_2:1624910_at:206:113; Interrogation_Position=1594; Antisense; AGCAGCTCCCATCTTTGGTGGATTC
>probe:Drosophila_2:1624910_at:57:253; Interrogation_Position=1662; Antisense; CAAACCGAAGGCGTGGCTTAGTCCA
>probe:Drosophila_2:1624910_at:660:165; Interrogation_Position=1707; Antisense; AAATGATATAGTTCCCCGCAACCAG
>probe:Drosophila_2:1624910_at:430:519; Interrogation_Position=1731; Antisense; GTGGATACTTCTTAACCTACAGGCA
>probe:Drosophila_2:1624910_at:316:179; Interrogation_Position=1773; Antisense; AAACTATGACGAGCTCACCTGGCAG
>probe:Drosophila_2:1624910_at:517:581; Interrogation_Position=1802; Antisense; TGGCTACCACGCTGTTCAATGATTT
>probe:Drosophila_2:1624910_at:309:663; Interrogation_Position=1835; Antisense; TAAATGTCCTAAACCGTGCCCAGAT
>probe:Drosophila_2:1624910_at:42:451; Interrogation_Position=1857; Antisense; GATCGTCAGCGATGTTCTATTCCTA
>probe:Drosophila_2:1624910_at:30:535; Interrogation_Position=1904; Antisense; GGTCGACCGCCCTTAATGTATTGAA
>probe:Drosophila_2:1624910_at:633:375; Interrogation_Position=1942; Antisense; GAAGACGAGTACGAACCCCTGATGG
>probe:Drosophila_2:1624910_at:451:67; Interrogation_Position=1963; Antisense; ATGGCTTTCGTTGTGGGCTGGACCA
>probe:Drosophila_2:1624910_at:428:429; Interrogation_Position=2065; Antisense; GAGTTCATCAGTTACACGTTCGACA
>probe:Drosophila_2:1624910_at:571:107; Interrogation_Position=2114; Antisense; AGAATCTGAATAGCCTCGACTACCC

Paste this into a BLAST search page for me
GTATTTCTGAAACAGGGCCACGCCCAGCAGCTCCCATCTTTGGTGGATTCCAAACCGAAGGCGTGGCTTAGTCCAAAATGATATAGTTCCCCGCAACCAGGTGGATACTTCTTAACCTACAGGCAAAACTATGACGAGCTCACCTGGCAGTGGCTACCACGCTGTTCAATGATTTTAAATGTCCTAAACCGTGCCCAGATGATCGTCAGCGATGTTCTATTCCTAGGTCGACCGCCCTTAATGTATTGAAGAAGACGAGTACGAACCCCTGATGGATGGCTTTCGTTGTGGGCTGGACCAGAGTTCATCAGTTACACGTTCGACAAGAATCTGAATAGCCTCGACTACCC

Full Affymetrix probeset data:

Annotations for 1624910_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime