FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624912_at:

>probe:Drosophila_2:1624912_at:74:47; Interrogation_Position=1078; Antisense; ATCCGTCACGATACGTTGCTCAGAT
>probe:Drosophila_2:1624912_at:622:29; Interrogation_Position=1109; Antisense; ATACTATTGCTGTCAGGGTCGCCAA
>probe:Drosophila_2:1624912_at:78:653; Interrogation_Position=671; Antisense; TCAACGACATGTCCCGGCTGCATAA
>probe:Drosophila_2:1624912_at:185:33; Interrogation_Position=695; Antisense; ATCAAGTTAACTTCTGCCAGGCCAG
>probe:Drosophila_2:1624912_at:669:313; Interrogation_Position=710; Antisense; GCCAGGCCAGTTTTCATTGCGAGCA
>probe:Drosophila_2:1624912_at:344:597; Interrogation_Position=777; Antisense; TGTCCTCATGACTAACTACGTTTCG
>probe:Drosophila_2:1624912_at:349:669; Interrogation_Position=793; Antisense; TACGTTTCGGAGTCACATTCGCACA
>probe:Drosophila_2:1624912_at:214:191; Interrogation_Position=820; Antisense; AACTCACTTCTTGCTCGACTAATTC
>probe:Drosophila_2:1624912_at:102:183; Interrogation_Position=848; Antisense; AAAACTCGTGTTTGTTGCCGTCGCT
>probe:Drosophila_2:1624912_at:346:595; Interrogation_Position=860; Antisense; TGTTGCCGTCGCTGGGAAATCTGAA
>probe:Drosophila_2:1624912_at:150:415; Interrogation_Position=943; Antisense; GACCAGATGGCTGTCAAGGATCGTA
>probe:Drosophila_2:1624912_at:492:483; Interrogation_Position=965; Antisense; GTAGTTCCAATGCAACCGACCAGTT
>probe:Drosophila_2:1624912_at:510:131; Interrogation_Position=979; Antisense; ACCGACCAGTTACGCTTTTATCAGA
>probe:Drosophila_2:1624912_at:332:647; Interrogation_Position=999; Antisense; TCAGACGTTACATTCCATCATCAAA

Paste this into a BLAST search page for me
ATCCGTCACGATACGTTGCTCAGATATACTATTGCTGTCAGGGTCGCCAATCAACGACATGTCCCGGCTGCATAAATCAAGTTAACTTCTGCCAGGCCAGGCCAGGCCAGTTTTCATTGCGAGCATGTCCTCATGACTAACTACGTTTCGTACGTTTCGGAGTCACATTCGCACAAACTCACTTCTTGCTCGACTAATTCAAAACTCGTGTTTGTTGCCGTCGCTTGTTGCCGTCGCTGGGAAATCTGAAGACCAGATGGCTGTCAAGGATCGTAGTAGTTCCAATGCAACCGACCAGTTACCGACCAGTTACGCTTTTATCAGATCAGACGTTACATTCCATCATCAAA

Full Affymetrix probeset data:

Annotations for 1624912_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720