Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624914_at:

>probe:Drosophila_2:1624914_at:140:605; Interrogation_Position=1208; Antisense; TGATTCTGCCGGGAGTCAGTGTCAC
>probe:Drosophila_2:1624914_at:487:529; Interrogation_Position=1299; Antisense; GGGTTGCAACTCGAATCCGAACATC
>probe:Drosophila_2:1624914_at:597:89; Interrogation_Position=1331; Antisense; AGTACACCCGCGATCCAGAGAGGAC
>probe:Drosophila_2:1624914_at:136:427; Interrogation_Position=1348; Antisense; GAGAGGACACCATTCCAGTGGACTG
>probe:Drosophila_2:1624914_at:57:305; Interrogation_Position=1384; Antisense; GCCGGTTTTACGAATGGATCCTCCA
>probe:Drosophila_2:1624914_at:284:259; Interrogation_Position=1418; Antisense; CACTGGCTGCTGACTATGCAACGAT
>probe:Drosophila_2:1624914_at:301:591; Interrogation_Position=1536; Antisense; TGGGTCCACAAAGTACCAGGCACTT
>probe:Drosophila_2:1624914_at:565:567; Interrogation_Position=1554; Antisense; GGCACTTTCTGAGGACATCTTCGTA
>probe:Drosophila_2:1624914_at:562:483; Interrogation_Position=1576; Antisense; GTAGTCCAACGATCTCTGACCAAAT
>probe:Drosophila_2:1624914_at:86:289; Interrogation_Position=1601; Antisense; CGGCCACCATTGTACTTGTCATTAA
>probe:Drosophila_2:1624914_at:209:649; Interrogation_Position=1659; Antisense; TCAGTTTGACAAGAGCCGTACCGAA
>probe:Drosophila_2:1624914_at:355:391; Interrogation_Position=1681; Antisense; GAAAGCCTGCAGCTGCTCATAAGAA
>probe:Drosophila_2:1624914_at:468:487; Interrogation_Position=1737; Antisense; GTACGATCCGAAAGCCTTGAGCCTG
>probe:Drosophila_2:1624914_at:259:447; Interrogation_Position=1762; Antisense; GATCCCTCGGAAGCCTTAGTCTTAA

Paste this into a BLAST search page for me
TGATTCTGCCGGGAGTCAGTGTCACGGGTTGCAACTCGAATCCGAACATCAGTACACCCGCGATCCAGAGAGGACGAGAGGACACCATTCCAGTGGACTGGCCGGTTTTACGAATGGATCCTCCACACTGGCTGCTGACTATGCAACGATTGGGTCCACAAAGTACCAGGCACTTGGCACTTTCTGAGGACATCTTCGTAGTAGTCCAACGATCTCTGACCAAATCGGCCACCATTGTACTTGTCATTAATCAGTTTGACAAGAGCCGTACCGAAGAAAGCCTGCAGCTGCTCATAAGAAGTACGATCCGAAAGCCTTGAGCCTGGATCCCTCGGAAGCCTTAGTCTTAA

Full Affymetrix probeset data:

Annotations for 1624914_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime