Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624916_a_at:

>probe:Drosophila_2:1624916_a_at:479:585; Interrogation_Position=124; Antisense; TGGAACGATTCGCACTGACAACCTG
>probe:Drosophila_2:1624916_a_at:159:345; Interrogation_Position=148; Antisense; GCATTCGCCGTGTCTGGATCATGTC
>probe:Drosophila_2:1624916_a_at:25:545; Interrogation_Position=163; Antisense; GGATCATGTCCGGATGGCTGCGCCA
>probe:Drosophila_2:1624916_a_at:685:155; Interrogation_Position=275; Antisense; ACAGCAGACTGCATCCAGTGGCGGT
>probe:Drosophila_2:1624916_a_at:494:677; Interrogation_Position=346; Antisense; TAGACGACTACATTGTGCCCTTTGA
>probe:Drosophila_2:1624916_a_at:360:625; Interrogation_Position=361; Antisense; TGCCCTTTGAATGCGGTCTTTGATT
>probe:Drosophila_2:1624916_a_at:673:711; Interrogation_Position=404; Antisense; TTCACCGATATGGTTCTGGGCCACA
>probe:Drosophila_2:1624916_a_at:305:595; Interrogation_Position=420; Antisense; TGGGCCACAGCGCAGTTAGTTCATT
>probe:Drosophila_2:1624916_a_at:507:717; Interrogation_Position=444; Antisense; TTCGCATTCGAAGCAGTTGGCATTC
>probe:Drosophila_2:1624916_a_at:587:725; Interrogation_Position=460; Antisense; TTGGCATTCAAGTAGTTCGATTCGT
>probe:Drosophila_2:1624916_a_at:324:509; Interrogation_Position=483; Antisense; GTGAAACCGCTTCTCCAAATTTTGG
>probe:Drosophila_2:1624916_a_at:79:565; Interrogation_Position=514; Antisense; GGAATCTTCATTGTATGCGCTCTAC
>probe:Drosophila_2:1624916_a_at:357:683; Interrogation_Position=527; Antisense; TATGCGCTCTACGTGGACGGAGAAC
>probe:Drosophila_2:1624916_a_at:491:483; Interrogation_Position=622; Antisense; GTAGTTCGCGTTAATCTCGACGTTT

Paste this into a BLAST search page for me
TGGAACGATTCGCACTGACAACCTGGCATTCGCCGTGTCTGGATCATGTCGGATCATGTCCGGATGGCTGCGCCAACAGCAGACTGCATCCAGTGGCGGTTAGACGACTACATTGTGCCCTTTGATGCCCTTTGAATGCGGTCTTTGATTTTCACCGATATGGTTCTGGGCCACATGGGCCACAGCGCAGTTAGTTCATTTTCGCATTCGAAGCAGTTGGCATTCTTGGCATTCAAGTAGTTCGATTCGTGTGAAACCGCTTCTCCAAATTTTGGGGAATCTTCATTGTATGCGCTCTACTATGCGCTCTACGTGGACGGAGAACGTAGTTCGCGTTAATCTCGACGTTT

Full Affymetrix probeset data:

Annotations for 1624916_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime