FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624917_at:

>probe:Drosophila_2:1624917_at:309:13; Interrogation_Position=2448; Antisense; ATTACGGGCTGGCAGAGCTTTTTAC
>probe:Drosophila_2:1624917_at:218:417; Interrogation_Position=2462; Antisense; GAGCTTTTTACATGGGTGTCCGATT
>probe:Drosophila_2:1624917_at:595:645; Interrogation_Position=2607; Antisense; TCTTGTTGACAAGTGCTGCAGCAGT
>probe:Drosophila_2:1624917_at:181:335; Interrogation_Position=2621; Antisense; GCTGCAGCAGTGACCCTGAAACAAT
>probe:Drosophila_2:1624917_at:36:463; Interrogation_Position=2692; Antisense; GATTACTACTCTTCTGATGATGCAA
>probe:Drosophila_2:1624917_at:298:223; Interrogation_Position=2745; Antisense; AAGGACTATATCCATAACCCTGGCC
>probe:Drosophila_2:1624917_at:598:363; Interrogation_Position=2796; Antisense; GAATTAAGTTCATTGCTCTGCTCTA
>probe:Drosophila_2:1624917_at:72:339; Interrogation_Position=2810; Antisense; GCTCTGCTCTATATGAGTTCTGAAA
>probe:Drosophila_2:1624917_at:31:689; Interrogation_Position=2839; Antisense; TATATTTCTCTCATCATTGGCTGCC
>probe:Drosophila_2:1624917_at:318:3; Interrogation_Position=2854; Antisense; ATTGGCTGCCAATTTAAAGTTCGAA
>probe:Drosophila_2:1624917_at:519:209; Interrogation_Position=2878; Antisense; AAGACTTGATAAGCCCTTTGGAAAG
>probe:Drosophila_2:1624917_at:414:19; Interrogation_Position=2907; Antisense; ATATTTTCCCTGTTCTATGGCGTAA
>probe:Drosophila_2:1624917_at:247:449; Interrogation_Position=2944; Antisense; GATCGCTTTGACATTAGACCACTTG
>probe:Drosophila_2:1624917_at:268:591; Interrogation_Position=2967; Antisense; TGGTGGAACCACGAAGTTTCTACTG

Paste this into a BLAST search page for me
ATTACGGGCTGGCAGAGCTTTTTACGAGCTTTTTACATGGGTGTCCGATTTCTTGTTGACAAGTGCTGCAGCAGTGCTGCAGCAGTGACCCTGAAACAATGATTACTACTCTTCTGATGATGCAAAAGGACTATATCCATAACCCTGGCCGAATTAAGTTCATTGCTCTGCTCTAGCTCTGCTCTATATGAGTTCTGAAATATATTTCTCTCATCATTGGCTGCCATTGGCTGCCAATTTAAAGTTCGAAAAGACTTGATAAGCCCTTTGGAAAGATATTTTCCCTGTTCTATGGCGTAAGATCGCTTTGACATTAGACCACTTGTGGTGGAACCACGAAGTTTCTACTG

Full Affymetrix probeset data:

Annotations for 1624917_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720