FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624919_at:

>probe:Drosophila_2:1624919_at:99:565; Interrogation_Position=1021; Antisense; GGAATTCAAACGACGCACGTGCCAG
>probe:Drosophila_2:1624919_at:502:355; Interrogation_Position=1035; Antisense; GCACGTGCCAGATTGTGGGCCTTAA
>probe:Drosophila_2:1624919_at:232:575; Interrogation_Position=1052; Antisense; GGCCTTAAGCCAGCCGGAGGAGTAA
>probe:Drosophila_2:1624919_at:380:103; Interrogation_Position=1077; Antisense; AGACTGTACGAGATGCGATCGCCTG
>probe:Drosophila_2:1624919_at:297:293; Interrogation_Position=1092; Antisense; CGATCGCCTGGATGACGTTGGTCAA
>probe:Drosophila_2:1624919_at:23:199; Interrogation_Position=1115; Antisense; AACGAAACTCTTGGCATCCGCTGGT
>probe:Drosophila_2:1624919_at:440:135; Interrogation_Position=1192; Antisense; ACGCGTTGTGCGTCAGGGTGTCAAA
>probe:Drosophila_2:1624919_at:180:181; Interrogation_Position=1241; Antisense; AAAAATGTGCCCGTGTCTCGCGAGG
>probe:Drosophila_2:1624919_at:581:437; Interrogation_Position=1313; Antisense; GAGGCCAACTGGTCGAATCCGTATT
>probe:Drosophila_2:1624919_at:720:481; Interrogation_Position=1333; Antisense; GTATTCTGGACTTTACTCACTCTAA
>probe:Drosophila_2:1624919_at:76:277; Interrogation_Position=824; Antisense; CTTATGCGCAGTGCCTGTGGACAAA
>probe:Drosophila_2:1624919_at:403:541; Interrogation_Position=940; Antisense; GGATTTTATCAAGACCTCAACGGGA
>probe:Drosophila_2:1624919_at:574:393; Interrogation_Position=963; Antisense; GAAAGGAGACAGTCAACGCCACCCT
>probe:Drosophila_2:1624919_at:496:625; Interrogation_Position=987; Antisense; TGCCCGTTGGCCTGGTCATGATATT

Paste this into a BLAST search page for me
GGAATTCAAACGACGCACGTGCCAGGCACGTGCCAGATTGTGGGCCTTAAGGCCTTAAGCCAGCCGGAGGAGTAAAGACTGTACGAGATGCGATCGCCTGCGATCGCCTGGATGACGTTGGTCAAAACGAAACTCTTGGCATCCGCTGGTACGCGTTGTGCGTCAGGGTGTCAAAAAAAATGTGCCCGTGTCTCGCGAGGGAGGCCAACTGGTCGAATCCGTATTGTATTCTGGACTTTACTCACTCTAACTTATGCGCAGTGCCTGTGGACAAAGGATTTTATCAAGACCTCAACGGGAGAAAGGAGACAGTCAACGCCACCCTTGCCCGTTGGCCTGGTCATGATATT

Full Affymetrix probeset data:

Annotations for 1624919_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720