FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624921_at:

>probe:Drosophila_2:1624921_at:44:31; Interrogation_Position=120; Antisense; ATACAACCTGCAGCCATCGAATGAC
>probe:Drosophila_2:1624921_at:336:369; Interrogation_Position=138; Antisense; GAATGACAGTCGCAACATCTACAAC
>probe:Drosophila_2:1624921_at:87:323; Interrogation_Position=247; Antisense; GCCCACCTGTTCAAGGCGCTAGCTG
>probe:Drosophila_2:1624921_at:286:505; Interrogation_Position=327; Antisense; GTCCTCCTCCAACGGCAACAATGAG
>probe:Drosophila_2:1624921_at:85:567; Interrogation_Position=340; Antisense; GGCAACAATGAGCACCAGGGATCAT
>probe:Drosophila_2:1624921_at:236:309; Interrogation_Position=354; Antisense; CCAGGGATCATCCTCGTTGGAAGCT
>probe:Drosophila_2:1624921_at:668:649; Interrogation_Position=37; Antisense; TCAAACCTTTCCAAGTCCCGGCATT
>probe:Drosophila_2:1624921_at:307:389; Interrogation_Position=379; Antisense; GAAAACGCCTTCCTAACTCATAATA
>probe:Drosophila_2:1624921_at:81:141; Interrogation_Position=404; Antisense; ACGGTGAGTCTCTAATGGGCAATGG
>probe:Drosophila_2:1624921_at:465:565; Interrogation_Position=421; Antisense; GGCAATGGATTCAAACTGGGTGTAC
>probe:Drosophila_2:1624921_at:637:141; Interrogation_Position=435; Antisense; ACTGGGTGTACGTCTTGTGTTTCAT
>probe:Drosophila_2:1624921_at:136:541; Interrogation_Position=56; Antisense; GGCATTTCACGGTCAACGGTCTTCT
>probe:Drosophila_2:1624921_at:94:197; Interrogation_Position=70; Antisense; AACGGTCTTCTGAGTGCCAATAACA
>probe:Drosophila_2:1624921_at:624:505; Interrogation_Position=83; Antisense; GTGCCAATAACACGTTCCAGCAGCA

Paste this into a BLAST search page for me
ATACAACCTGCAGCCATCGAATGACGAATGACAGTCGCAACATCTACAACGCCCACCTGTTCAAGGCGCTAGCTGGTCCTCCTCCAACGGCAACAATGAGGGCAACAATGAGCACCAGGGATCATCCAGGGATCATCCTCGTTGGAAGCTTCAAACCTTTCCAAGTCCCGGCATTGAAAACGCCTTCCTAACTCATAATAACGGTGAGTCTCTAATGGGCAATGGGGCAATGGATTCAAACTGGGTGTACACTGGGTGTACGTCTTGTGTTTCATGGCATTTCACGGTCAACGGTCTTCTAACGGTCTTCTGAGTGCCAATAACAGTGCCAATAACACGTTCCAGCAGCA

Full Affymetrix probeset data:

Annotations for 1624921_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720