FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624926_at:

>probe:Drosophila_2:1624926_at:62:259; Interrogation_Position=104; Antisense; CACAGTTGAGCTGGTGGCACAAACA
>probe:Drosophila_2:1624926_at:304:567; Interrogation_Position=119; Antisense; GGCACAAACAGTACTACCAGTCGCT
>probe:Drosophila_2:1624926_at:689:153; Interrogation_Position=126; Antisense; ACAGTACTACCAGTCGCTATGGCAA
>probe:Drosophila_2:1624926_at:526:65; Interrogation_Position=13; Antisense; ATGGTCTCCAAGTGGCTGCGCATCT
>probe:Drosophila_2:1624926_at:100:341; Interrogation_Position=141; Antisense; GCTATGGCAACAGAGGCTGCGGTTT
>probe:Drosophila_2:1624926_at:54:101; Interrogation_Position=152; Antisense; AGAGGCTGCGGTTTACGACGACTCC
>probe:Drosophila_2:1624926_at:134:555; Interrogation_Position=184; Antisense; GGAGCCACTCCCGAATCGGATGAAG
>probe:Drosophila_2:1624926_at:635:379; Interrogation_Position=205; Antisense; GAAGCCAGATTGGTGTATCCCTGCT
>probe:Drosophila_2:1624926_at:621:533; Interrogation_Position=216; Antisense; GGTGTATCCCTGCTACTGCTACAAG
>probe:Drosophila_2:1624926_at:460:143; Interrogation_Position=230; Antisense; ACTGCTACAAGCCAACTCCCGAGGG
>probe:Drosophila_2:1624926_at:445:267; Interrogation_Position=267; Antisense; CAGTCCGGTGGAGCAGCGAATGATT
>probe:Drosophila_2:1624926_at:578:335; Interrogation_Position=27; Antisense; GCTGCGCATCTTGGTTCTATTTCTT
>probe:Drosophila_2:1624926_at:181:715; Interrogation_Position=41; Antisense; TTCTATTTCTTCTGGGTCTTGCAAC
>probe:Drosophila_2:1624926_at:6:431; Interrogation_Position=91; Antisense; GAGTCGCCGAAACCACAGTTGAGCT

Paste this into a BLAST search page for me
CACAGTTGAGCTGGTGGCACAAACAGGCACAAACAGTACTACCAGTCGCTACAGTACTACCAGTCGCTATGGCAAATGGTCTCCAAGTGGCTGCGCATCTGCTATGGCAACAGAGGCTGCGGTTTAGAGGCTGCGGTTTACGACGACTCCGGAGCCACTCCCGAATCGGATGAAGGAAGCCAGATTGGTGTATCCCTGCTGGTGTATCCCTGCTACTGCTACAAGACTGCTACAAGCCAACTCCCGAGGGCAGTCCGGTGGAGCAGCGAATGATTGCTGCGCATCTTGGTTCTATTTCTTTTCTATTTCTTCTGGGTCTTGCAACGAGTCGCCGAAACCACAGTTGAGCT

Full Affymetrix probeset data:

Annotations for 1624926_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720