FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624928_at:

>probe:Drosophila_2:1624928_at:635:277; Interrogation_Position=2409; Antisense; CTATGAGGAGGCTGTTGCGGCCATT
>probe:Drosophila_2:1624928_at:254:147; Interrogation_Position=2459; Antisense; ACTACCAGGCGCTGCTCGGATCAGA
>probe:Drosophila_2:1624928_at:341:153; Interrogation_Position=2499; Antisense; ACAGGTGGTCACAGTCGAGGCCGCC
>probe:Drosophila_2:1624928_at:318:215; Interrogation_Position=2594; Antisense; AAGTTGTGGAACTTCTGGTGTCCGG
>probe:Drosophila_2:1624928_at:145:593; Interrogation_Position=2609; Antisense; TGGTGTCCGGTGTTATGGATGACCT
>probe:Drosophila_2:1624928_at:481:131; Interrogation_Position=2630; Antisense; ACCTGGTGGACTCCAGTGACCTGGA
>probe:Drosophila_2:1624928_at:556:289; Interrogation_Position=2655; Antisense; CGAGGAAGTGCGCAATTTCTTTTTT
>probe:Drosophila_2:1624928_at:58:355; Interrogation_Position=2683; Antisense; GCAGCCAGCAAGTCATTTTTGTCGT
>probe:Drosophila_2:1624928_at:607:273; Interrogation_Position=2772; Antisense; CATTCACTTGCCATTTCTCGATTAA
>probe:Drosophila_2:1624928_at:136:167; Interrogation_Position=2795; Antisense; AAATGCCATATTACTTAAGCTCAGG
>probe:Drosophila_2:1624928_at:81:247; Interrogation_Position=2896; Antisense; AATTCACTTCCGCAAATTCATGCTG
>probe:Drosophila_2:1624928_at:685:391; Interrogation_Position=2926; Antisense; GAAAGTTTTCTAACAGTCCTCAATA
>probe:Drosophila_2:1624928_at:719:5; Interrogation_Position=2950; Antisense; ATTGTTATCTCGTTATCGTCCGTGC
>probe:Drosophila_2:1624928_at:205:505; Interrogation_Position=2971; Antisense; GTGCTTTCGTAGCTAGCTCCTACAA

Paste this into a BLAST search page for me
CTATGAGGAGGCTGTTGCGGCCATTACTACCAGGCGCTGCTCGGATCAGAACAGGTGGTCACAGTCGAGGCCGCCAAGTTGTGGAACTTCTGGTGTCCGGTGGTGTCCGGTGTTATGGATGACCTACCTGGTGGACTCCAGTGACCTGGACGAGGAAGTGCGCAATTTCTTTTTTGCAGCCAGCAAGTCATTTTTGTCGTCATTCACTTGCCATTTCTCGATTAAAAATGCCATATTACTTAAGCTCAGGAATTCACTTCCGCAAATTCATGCTGGAAAGTTTTCTAACAGTCCTCAATAATTGTTATCTCGTTATCGTCCGTGCGTGCTTTCGTAGCTAGCTCCTACAA

Full Affymetrix probeset data:

Annotations for 1624928_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720