Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624929_at:

>probe:Drosophila_2:1624929_at:516:171; Interrogation_Position=103; Antisense; AAAGATCCAAACAGCGCCATCGAAA
>probe:Drosophila_2:1624929_at:189:255; Interrogation_Position=192; Antisense; CAGGCCACTTAACACCGTCGAATTA
>probe:Drosophila_2:1624929_at:397:237; Interrogation_Position=217; Antisense; AATCGAGTCAAATCAGGCGGATCCA
>probe:Drosophila_2:1624929_at:164:71; Interrogation_Position=231; Antisense; AGGCGGATCCAAGATGCTCACCAGA
>probe:Drosophila_2:1624929_at:305:291; Interrogation_Position=317; Antisense; CGTGCGAGTCCCTCAAGAAGCTGGA
>probe:Drosophila_2:1624929_at:550:557; Interrogation_Position=339; Antisense; GGACTACACAAAGATGCCCAGTTCT
>probe:Drosophila_2:1624929_at:391:315; Interrogation_Position=380; Antisense; GCCTGCTGCCACTGAGGGAAACGTT
>probe:Drosophila_2:1624929_at:346:587; Interrogation_Position=404; Antisense; TGGACGATTGTTTCAAGCGCTTGAC
>probe:Drosophila_2:1624929_at:9:437; Interrogation_Position=454; Antisense; GAGGATCCCGTATACCAGCAGAAAT
>probe:Drosophila_2:1624929_at:264:381; Interrogation_Position=46; Antisense; GAACCGGAGAAGATTGCCACGCGAA
>probe:Drosophila_2:1624929_at:303:455; Interrogation_Position=532; Antisense; GATAAAGCCCAGTCCGGAGCAACAA
>probe:Drosophila_2:1624929_at:412:295; Interrogation_Position=569; Antisense; CGACGACAACGATAGCGGCGAGCTG
>probe:Drosophila_2:1624929_at:78:289; Interrogation_Position=584; Antisense; CGGCGAGCTGCGATTTAAACAATTT
>probe:Drosophila_2:1624929_at:721:385; Interrogation_Position=73; Antisense; GAAAAATTGGTGCTAAGACCCCGCT

Paste this into a BLAST search page for me
AAAGATCCAAACAGCGCCATCGAAACAGGCCACTTAACACCGTCGAATTAAATCGAGTCAAATCAGGCGGATCCAAGGCGGATCCAAGATGCTCACCAGACGTGCGAGTCCCTCAAGAAGCTGGAGGACTACACAAAGATGCCCAGTTCTGCCTGCTGCCACTGAGGGAAACGTTTGGACGATTGTTTCAAGCGCTTGACGAGGATCCCGTATACCAGCAGAAATGAACCGGAGAAGATTGCCACGCGAAGATAAAGCCCAGTCCGGAGCAACAACGACGACAACGATAGCGGCGAGCTGCGGCGAGCTGCGATTTAAACAATTTGAAAAATTGGTGCTAAGACCCCGCT

Full Affymetrix probeset data:

Annotations for 1624929_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime