FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624931_at:

>probe:Drosophila_2:1624931_at:169:397; Interrogation_Position=1000; Antisense; GACACGCAAAACGTATGAAGCGTAT
>probe:Drosophila_2:1624931_at:643:393; Interrogation_Position=1043; Antisense; GAAATACGGTAGAAAAGCATCTATA
>probe:Drosophila_2:1624931_at:317:151; Interrogation_Position=1114; Antisense; ACATACGATATATTTATACTGGGAA
>probe:Drosophila_2:1624931_at:400:11; Interrogation_Position=828; Antisense; ATTCGTCTATCCCATATATATTTGT
>probe:Drosophila_2:1624931_at:146:293; Interrogation_Position=831; Antisense; CGTCTATCCCATATATATTTGTGCA
>probe:Drosophila_2:1624931_at:2:687; Interrogation_Position=844; Antisense; TATATTTGTGCATAAATGTTTCCAA
>probe:Drosophila_2:1624931_at:377:661; Interrogation_Position=856; Antisense; TAAATGTTTCCAAAACACACGACAA
>probe:Drosophila_2:1624931_at:102:157; Interrogation_Position=872; Antisense; ACACGACAAACACACACATCATCAT
>probe:Drosophila_2:1624931_at:713:257; Interrogation_Position=884; Antisense; CACACATCATCATCGGAGGAAGAAT
>probe:Drosophila_2:1624931_at:1:201; Interrogation_Position=911; Antisense; AACGCAGATACAAAGCAATACGACA
>probe:Drosophila_2:1624931_at:286:171; Interrogation_Position=922; Antisense; AAAGCAATACGACAGCCAACTCACT
>probe:Drosophila_2:1624931_at:709:399; Interrogation_Position=932; Antisense; GACAGCCAACTCACTCAGAACATTT
>probe:Drosophila_2:1624931_at:613:311; Interrogation_Position=936; Antisense; GCCAACTCACTCAGAACATTTACAC
>probe:Drosophila_2:1624931_at:196:281; Interrogation_Position=941; Antisense; CTCACTCAGAACATTTACACAAGAA

Paste this into a BLAST search page for me
GACACGCAAAACGTATGAAGCGTATGAAATACGGTAGAAAAGCATCTATAACATACGATATATTTATACTGGGAAATTCGTCTATCCCATATATATTTGTCGTCTATCCCATATATATTTGTGCATATATTTGTGCATAAATGTTTCCAATAAATGTTTCCAAAACACACGACAAACACGACAAACACACACATCATCATCACACATCATCATCGGAGGAAGAATAACGCAGATACAAAGCAATACGACAAAAGCAATACGACAGCCAACTCACTGACAGCCAACTCACTCAGAACATTTGCCAACTCACTCAGAACATTTACACCTCACTCAGAACATTTACACAAGAA

Full Affymetrix probeset data:

Annotations for 1624931_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720