FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624932_at:

>probe:Drosophila_2:1624932_at:470:33; Interrogation_Position=183; Antisense; ATCAAGTTTGACATGACTCCGCCGC
>probe:Drosophila_2:1624932_at:676:447; Interrogation_Position=232; Antisense; GATCCTTTGAGAGCAAGCGTCGTCA
>probe:Drosophila_2:1624932_at:392:713; Interrogation_Position=282; Antisense; TTCTTCTCCTGCATCTTTAACGAGA
>probe:Drosophila_2:1624932_at:87:175; Interrogation_Position=341; Antisense; AAAGCTGAACGCCTACTTGCAGGAG
>probe:Drosophila_2:1624932_at:154:277; Interrogation_Position=353; Antisense; CTACTTGCAGGAGGTCTTCGAGGAC
>probe:Drosophila_2:1624932_at:61:439; Interrogation_Position=372; Antisense; GAGGACAGTTCTGATCTGCAGACCA
>probe:Drosophila_2:1624932_at:727:307; Interrogation_Position=427; Antisense; CCAAAGTCGCGGATTTCGAGGCCAA
>probe:Drosophila_2:1624932_at:634:137; Interrogation_Position=505; Antisense; ACGATGCTGGTCACCTCATGGGCTG
>probe:Drosophila_2:1624932_at:632:279; Interrogation_Position=519; Antisense; CTCATGGGCTGTGTGTTCCGCAATA
>probe:Drosophila_2:1624932_at:130:363; Interrogation_Position=551; Antisense; GAATTGCCCAGACTCAATACGGAAT
>probe:Drosophila_2:1624932_at:655:717; Interrogation_Position=578; Antisense; TTCCCAGCAGTGCACTGACATGAAA
>probe:Drosophila_2:1624932_at:287:429; Interrogation_Position=603; Antisense; GAGTTCTTCACCAAGTGCAAGCCAC
>probe:Drosophila_2:1624932_at:519:185; Interrogation_Position=676; Antisense; AATCCTATTTGTCTGAAAACCCGCA
>probe:Drosophila_2:1624932_at:700:223; Interrogation_Position=700; Antisense; AATGAATTTACCTCTACCAAGCCGA

Paste this into a BLAST search page for me
ATCAAGTTTGACATGACTCCGCCGCGATCCTTTGAGAGCAAGCGTCGTCATTCTTCTCCTGCATCTTTAACGAGAAAAGCTGAACGCCTACTTGCAGGAGCTACTTGCAGGAGGTCTTCGAGGACGAGGACAGTTCTGATCTGCAGACCACCAAAGTCGCGGATTTCGAGGCCAAACGATGCTGGTCACCTCATGGGCTGCTCATGGGCTGTGTGTTCCGCAATAGAATTGCCCAGACTCAATACGGAATTTCCCAGCAGTGCACTGACATGAAAGAGTTCTTCACCAAGTGCAAGCCACAATCCTATTTGTCTGAAAACCCGCAAATGAATTTACCTCTACCAAGCCGA

Full Affymetrix probeset data:

Annotations for 1624932_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720